Mutagenetix > Incidental Mutation

Incidental Mutation 'R0907:Qdpr'

83354

Institutional Source

Beutler Lab

Gene Symbol

Qdpr

Ensembl Gene

ENSMUSG00000015806

Gene Name

quinoid dihydropteridine reductase

Synonyms

2610008L04Rik

MMRRC Submission

039065-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.221) question?

Stock #

R0907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45591374-45607571 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 45596728 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 145 (I145M)

Ref Sequence

ENSEMBL: ENSMUSP00000015950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000117425] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000198258] [ENSMUST00000197946]

AlphaFold

Q8BVI4

Predicted Effect

probably benign
Transcript: ENSMUST00000015950
AA Change: I145M

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806
AA Change: I145M

Domain	Start	End	E-Value	Type
Pfam:adh_short	8	195	5.4e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117425
AA Change: I93M

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000112469
Gene: ENSMUSG00000015806
AA Change: I93M

Domain	Start	End	E-Value	Type
PDB:1DIR\|D	1	189	1e-124	PDB
SCOP:d1hdr__	7	189	4e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118097
AA Change: I93M

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806
AA Change: I93M

Domain	Start	End	E-Value	Type
PDB:1DIR\|D	1	189	1e-124	PDB
SCOP:d1hdr__	7	189	4e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120867
AA Change: I93M

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806
AA Change: I93M

Domain	Start	End	E-Value	Type
PDB:1DIR\|D	1	189	1e-124	PDB
SCOP:d1hdr__	7	189	4e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127562

SMART Domains

Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806

Domain	Start	End	E-Value	Type
PDB:1DIR\|D	1	137	7e-67	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149290

Predicted Effect

probably benign
Transcript: ENSMUST00000154962
AA Change: I145M

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806
AA Change: I145M

Domain	Start	End	E-Value	Type
PDB:1DIR\|D	1	159	7e-72	PDB
SCOP:d1hdr__	6	159	6e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000198258
AA Change: I43M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806
AA Change: I43M

Domain	Start	End	E-Value	Type
PDB:1DIR\|D	1	139	8e-86	PDB
SCOP:d1hdr__	14	139	6e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197946
AA Change: I145M

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806
AA Change: I145M

Domain	Start	End	E-Value	Type
PDB:1DIR\|D	1	213	1e-125	PDB
SCOP:d1hdr__	6	162	2e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196216

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200259

Meta Mutation Damage Score

0.1067

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
PHENOTYPE: A portion of mice homozygous for a knock-out allele display abnormal rib-sternum attachment, a split xiphoid process, and lumbar vertebral transformation. Another knock-out allele exhibits abnormal folate and biopterin metabolism and oxidative stress in the liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl2	G	A	1: 156,457,429 (GRCm39)	V225M	probably damaging	Het
Afmid	T	A	11: 117,726,416 (GRCm39)		probably benign	Het
Ccdc191	G	A	16: 43,735,901 (GRCm39)	V216I	probably benign	Het
Cep112	C	A	11: 108,461,258 (GRCm39)		probably benign	Het
Dcbld1	T	C	10: 52,137,910 (GRCm39)	V58A	possibly damaging	Het
Dop1b	A	T	16: 93,598,481 (GRCm39)	H1882L	probably damaging	Het
Fat1	A	G	8: 45,479,635 (GRCm39)	I2894V	probably benign	Het
Focad	T	C	4: 88,196,498 (GRCm39)		probably null	Het
Gm45713	G	A	7: 44,781,788 (GRCm39)	T203M	possibly damaging	Het
Gstm1	T	C	3: 107,924,696 (GRCm39)	Y28C	probably damaging	Het
Gucy1a1	T	C	3: 82,018,498 (GRCm39)	D113G	probably benign	Het
Hat1	G	T	2: 71,250,961 (GRCm39)	E170*	probably null	Het
Herc1	C	A	9: 66,340,710 (GRCm39)	F1686L	possibly damaging	Het
Iffo1	A	G	6: 125,130,124 (GRCm39)	E270G	probably null	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Lrp3	A	T	7: 34,902,718 (GRCm39)	Y522N	probably damaging	Het
Lrp6	A	T	6: 134,484,488 (GRCm39)	D378E	probably damaging	Het
Mmrn1	A	G	6: 60,950,103 (GRCm39)	N351S	probably benign	Het
Or1e16	A	T	11: 73,285,945 (GRCm39)	L301Q	probably damaging	Het
Or9q1	T	C	19: 13,805,220 (GRCm39)	D180G	probably damaging	Het
Pcnx3	T	C	19: 5,721,553 (GRCm39)	K1082E	possibly damaging	Het
Pikfyve	T	C	1: 65,241,989 (GRCm39)	V243A	possibly damaging	Het
Rasgrp3	G	T	17: 75,816,822 (GRCm39)		probably null	Het
Rd3l	G	T	12: 111,946,574 (GRCm39)	Y1*	probably null	Het
Sf3b3	A	G	8: 111,538,142 (GRCm39)		probably benign	Het
Smn1	C	T	13: 100,264,404 (GRCm39)	T45I	probably damaging	Het
Sprr3	A	T	3: 92,364,316 (GRCm39)	I176N	probably benign	Het
Sv2c	T	C	13: 96,224,763 (GRCm39)	D182G	probably damaging	Het
Tnni3k	A	T	3: 154,647,316 (GRCm39)	V397D	probably damaging	Het
Trpt1	G	T	19: 6,976,308 (GRCm39)	G235V	possibly damaging	Het
Ttll10	A	T	4: 156,120,621 (GRCm39)	C367*	probably null	Het
Unc5c	A	G	3: 141,494,794 (GRCm39)	Q369R	probably damaging	Het

Other mutations in Qdpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02114:Qdpr	APN	5	45,592,018 (GRCm39)	missense	possibly damaging	0.93
R1387:Qdpr	UTSW	5	45,607,480 (GRCm39)	start gained	probably benign
R1964:Qdpr	UTSW	5	45,596,660 (GRCm39)	missense	possibly damaging	0.58
R2431:Qdpr	UTSW	5	45,602,072 (GRCm39)	missense	probably damaging	1.00
R4586:Qdpr	UTSW	5	45,596,669 (GRCm39)	missense	possibly damaging	0.60
R5678:Qdpr	UTSW	5	45,604,979 (GRCm39)	missense	possibly damaging	0.65
R5754:Qdpr	UTSW	5	45,596,727 (GRCm39)	missense	probably damaging	0.98
R7392:Qdpr	UTSW	5	45,596,718 (GRCm39)	missense	probably benign	0.37
R7939:Qdpr	UTSW	5	45,607,407 (GRCm39)	missense	probably damaging	1.00
R8482:Qdpr	UTSW	5	45,596,688 (GRCm39)	missense	probably benign	0.05
R8891:Qdpr	UTSW	5	45,604,982 (GRCm39)	missense	probably damaging	0.99
R8993:Qdpr	UTSW	5	45,607,386 (GRCm39)	missense	probably damaging	1.00
R9445:Qdpr	UTSW	5	45,596,669 (GRCm39)	missense	probably benign
X0022:Qdpr	UTSW	5	45,596,697 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCCTCTCAAACTGTCAGCACTC -3'
(R):5'- AATAGCTTGTGGCACCATGCCC -3'

Sequencing Primer
(F):5'- TCAGCACTCAGCAGTGGAC -3'
(R):5'- TGCACTTTTGGAAACCGGC -3'

Posted On

2013-11-08