Incidental Mutation 'R0907:Or1e16'
ID 83364
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 039065-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R0907 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73285945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 301 (L301Q)
Ref Sequence ENSEMBL: ENSMUSP00000113707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably damaging
Transcript: ENSMUST00000120303
AA Change: L301Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823
AA Change: L301Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206193
Meta Mutation Damage Score 0.8520 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,457,429 (GRCm39) V225M probably damaging Het
Afmid T A 11: 117,726,416 (GRCm39) probably benign Het
Ccdc191 G A 16: 43,735,901 (GRCm39) V216I probably benign Het
Cep112 C A 11: 108,461,258 (GRCm39) probably benign Het
Dcbld1 T C 10: 52,137,910 (GRCm39) V58A possibly damaging Het
Dop1b A T 16: 93,598,481 (GRCm39) H1882L probably damaging Het
Fat1 A G 8: 45,479,635 (GRCm39) I2894V probably benign Het
Focad T C 4: 88,196,498 (GRCm39) probably null Het
Gm45713 G A 7: 44,781,788 (GRCm39) T203M possibly damaging Het
Gstm1 T C 3: 107,924,696 (GRCm39) Y28C probably damaging Het
Gucy1a1 T C 3: 82,018,498 (GRCm39) D113G probably benign Het
Hat1 G T 2: 71,250,961 (GRCm39) E170* probably null Het
Herc1 C A 9: 66,340,710 (GRCm39) F1686L possibly damaging Het
Iffo1 A G 6: 125,130,124 (GRCm39) E270G probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lrp3 A T 7: 34,902,718 (GRCm39) Y522N probably damaging Het
Lrp6 A T 6: 134,484,488 (GRCm39) D378E probably damaging Het
Mmrn1 A G 6: 60,950,103 (GRCm39) N351S probably benign Het
Or9q1 T C 19: 13,805,220 (GRCm39) D180G probably damaging Het
Pcnx3 T C 19: 5,721,553 (GRCm39) K1082E possibly damaging Het
Pikfyve T C 1: 65,241,989 (GRCm39) V243A possibly damaging Het
Qdpr G C 5: 45,596,728 (GRCm39) I145M probably benign Het
Rasgrp3 G T 17: 75,816,822 (GRCm39) probably null Het
Rd3l G T 12: 111,946,574 (GRCm39) Y1* probably null Het
Sf3b3 A G 8: 111,538,142 (GRCm39) probably benign Het
Smn1 C T 13: 100,264,404 (GRCm39) T45I probably damaging Het
Sprr3 A T 3: 92,364,316 (GRCm39) I176N probably benign Het
Sv2c T C 13: 96,224,763 (GRCm39) D182G probably damaging Het
Tnni3k A T 3: 154,647,316 (GRCm39) V397D probably damaging Het
Trpt1 G T 19: 6,976,308 (GRCm39) G235V possibly damaging Het
Ttll10 A T 4: 156,120,621 (GRCm39) C367* probably null Het
Unc5c A G 3: 141,494,794 (GRCm39) Q369R probably damaging Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GAAAGGTGACTCAGGTCCCTCAAAC -3'
(R):5'- ATGCTGCACACCCTGCTTATGG -3'

Sequencing Primer
(F):5'- CAAACCCAGTTTCCTTGTTAAACTAC -3'
(R):5'- CTGTGAGGACAATGTGATCCC -3'
Posted On 2013-11-08