Incidental Mutation 'R0907:Afmid'
ID83366
Institutional Source Beutler Lab
Gene Symbol Afmid
Ensembl Gene ENSMUSG00000017718
Gene Namearylformamidase
Synonyms9030621K19Rik, formylkynureninase, formylase, kynurenine formamidase, Kf
MMRRC Submission 039065-MU
Accession Numbers

Genbank: NM_027827; MGI: 2448704

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0907 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117825924-117839908 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 117835590 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073388] [ENSMUST00000132298] [ENSMUST00000149668]
Predicted Effect probably benign
Transcript: ENSMUST00000073388
SMART Domains Protein: ENSMUSP00000073102
Gene: ENSMUSG00000017718

DomainStartEndE-ValueType
Pfam:COesterase 34 139 1.1e-6 PFAM
Pfam:Abhydrolase_5 88 280 4.1e-12 PFAM
Pfam:Abhydrolase_3 89 283 7.8e-19 PFAM
Pfam:Peptidase_S9 106 296 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131268
Predicted Effect probably benign
Transcript: ENSMUST00000132298
SMART Domains Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148016
Predicted Effect probably benign
Transcript: ENSMUST00000149668
SMART Domains Protein: ENSMUSP00000119310
Gene: ENSMUSG00000017718

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 80 272 9.1e-12 PFAM
Pfam:Abhydrolase_3 81 273 1.7e-17 PFAM
Pfam:Peptidase_S9 101 287 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153850
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit polydipsia, polyuria and hyperglycemia. Mice homozygous for a full exon 2 deletion show impaired glucose tolerance due to reduced insulin secretion associated with reduced islet mass. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(12)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,629,859 V225M probably damaging Het
Ccdc191 G A 16: 43,915,538 V216I probably benign Het
Cep112 C A 11: 108,570,432 probably benign Het
Dcbld1 T C 10: 52,261,814 V58A possibly damaging Het
Dopey2 A T 16: 93,801,593 H1882L probably damaging Het
Fat1 A G 8: 45,026,598 I2894V probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gm45713 G A 7: 45,132,364 T203M possibly damaging Het
Gstm1 T C 3: 108,017,380 Y28C probably damaging Het
Gucy1a1 T C 3: 82,111,191 D113G probably benign Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Herc1 C A 9: 66,433,428 F1686L possibly damaging Het
Iffo1 A G 6: 125,153,161 E270G probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrp3 A T 7: 35,203,293 Y522N probably damaging Het
Lrp6 A T 6: 134,507,525 D378E probably damaging Het
Mmrn1 A G 6: 60,973,119 N351S probably benign Het
Olfr1 A T 11: 73,395,119 L301Q probably damaging Het
Olfr1500 T C 19: 13,827,856 D180G probably damaging Het
Pcnx3 T C 19: 5,671,525 K1082E possibly damaging Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Qdpr G C 5: 45,439,386 I145M probably benign Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rd3l G T 12: 111,980,140 Y1* probably null Het
Sf3b3 A G 8: 110,811,510 probably benign Het
Smn1 C T 13: 100,127,896 T45I probably damaging Het
Sprr3 A T 3: 92,457,009 I176N probably benign Het
Sv2c T C 13: 96,088,255 D182G probably damaging Het
Tnni3k A T 3: 154,941,679 V397D probably damaging Het
Trpt1 G T 19: 6,998,940 G235V possibly damaging Het
Ttll10 A T 4: 156,036,164 C367* probably null Het
Unc5c A G 3: 141,789,033 Q369R probably damaging Het
Other mutations in Afmid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Afmid APN 11 117836426 missense probably damaging 0.99
IGL02205:Afmid APN 11 117835156 missense probably damaging 1.00
IGL02657:Afmid APN 11 117834822 missense possibly damaging 0.72
2107:Afmid UTSW 11 117835561 missense probably damaging 1.00
R0371:Afmid UTSW 11 117835140 splice site probably benign
R0941:Afmid UTSW 11 117835245 splice site probably benign
R1915:Afmid UTSW 11 117835799 missense possibly damaging 0.96
R1975:Afmid UTSW 11 117836474 missense probably benign 0.07
R2034:Afmid UTSW 11 117835235 missense probably benign 0.07
R4064:Afmid UTSW 11 117836528 missense probably benign 0.00
R5386:Afmid UTSW 11 117828142 missense probably benign
R5815:Afmid UTSW 11 117835704 missense probably benign 0.17
R7075:Afmid UTSW 11 117835705 missense probably benign
R7185:Afmid UTSW 11 117834773 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGAGGAGACCCTTCTTTGCCTCTG -3'
(R):5'- AGGAGACCACATGATGCTGAACCC -3'

Sequencing Primer
(F):5'- TCTGCCCACAGTCCTGG -3'
(R):5'- GTTAGCAGTACCTCGTAGAACTC -3'
Posted On2013-11-08