Incidental Mutation 'R0907:Ccdc191'
ID 83370
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
MMRRC Submission 039065-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R0907 (G1)
Quality Score 217
Status Validated
Chromosome 16
Chromosomal Location 43889800-43964314 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43915538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 216 (V216I)
Ref Sequence ENSEMBL: ENSMUSP00000116078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122014] [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122014
SMART Domains Protein: ENSMUSP00000112569
Gene: ENSMUSG00000022701

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132859
AA Change: V216I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: V216I

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146343
Predicted Effect probably benign
Transcript: ENSMUST00000178400
AA Change: V274I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: V274I

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,629,859 (GRCm38) V225M probably damaging Het
Afmid T A 11: 117,835,590 (GRCm38) probably benign Het
Cep112 C A 11: 108,570,432 (GRCm38) probably benign Het
Dcbld1 T C 10: 52,261,814 (GRCm38) V58A possibly damaging Het
Dop1b A T 16: 93,801,593 (GRCm38) H1882L probably damaging Het
Fat1 A G 8: 45,026,598 (GRCm38) I2894V probably benign Het
Focad T C 4: 88,278,261 (GRCm38) probably null Het
Gm45713 G A 7: 45,132,364 (GRCm38) T203M possibly damaging Het
Gstm1 T C 3: 108,017,380 (GRCm38) Y28C probably damaging Het
Gucy1a1 T C 3: 82,111,191 (GRCm38) D113G probably benign Het
Hat1 G T 2: 71,420,617 (GRCm38) E170* probably null Het
Herc1 C A 9: 66,433,428 (GRCm38) F1686L possibly damaging Het
Iffo1 A G 6: 125,153,161 (GRCm38) E270G probably null Het
Lgr6 C T 1: 134,994,010 (GRCm38) A199T probably damaging Het
Lrp3 A T 7: 35,203,293 (GRCm38) Y522N probably damaging Het
Lrp6 A T 6: 134,507,525 (GRCm38) D378E probably damaging Het
Mmrn1 A G 6: 60,973,119 (GRCm38) N351S probably benign Het
Or1e16 A T 11: 73,395,119 (GRCm38) L301Q probably damaging Het
Or9q1 T C 19: 13,827,856 (GRCm38) D180G probably damaging Het
Pcnx3 T C 19: 5,671,525 (GRCm38) K1082E possibly damaging Het
Pikfyve T C 1: 65,202,830 (GRCm38) V243A possibly damaging Het
Qdpr G C 5: 45,439,386 (GRCm38) I145M probably benign Het
Rasgrp3 G T 17: 75,509,827 (GRCm38) probably null Het
Rd3l G T 12: 111,980,140 (GRCm38) Y1* probably null Het
Sf3b3 A G 8: 110,811,510 (GRCm38) probably benign Het
Smn1 C T 13: 100,127,896 (GRCm38) T45I probably damaging Het
Sprr3 A T 3: 92,457,009 (GRCm38) I176N probably benign Het
Sv2c T C 13: 96,088,255 (GRCm38) D182G probably damaging Het
Tnni3k A T 3: 154,941,679 (GRCm38) V397D probably damaging Het
Trpt1 G T 19: 6,998,940 (GRCm38) G235V possibly damaging Het
Ttll10 A T 4: 156,036,164 (GRCm38) C367* probably null Het
Unc5c A G 3: 141,789,033 (GRCm38) Q369R probably damaging Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43,959,300 (GRCm38) missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43,960,022 (GRCm38) missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43,956,894 (GRCm38) missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43,960,099 (GRCm38) missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43,921,801 (GRCm38) intron probably benign
R0238:Ccdc191 UTSW 16 43,947,496 (GRCm38) nonsense probably null
R0238:Ccdc191 UTSW 16 43,947,496 (GRCm38) nonsense probably null
R0346:Ccdc191 UTSW 16 43,938,952 (GRCm38) missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43,931,341 (GRCm38) nonsense probably null
R0930:Ccdc191 UTSW 16 43,931,255 (GRCm38) missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43,943,510 (GRCm38) missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43,908,635 (GRCm38) missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43,931,198 (GRCm38) missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43,943,967 (GRCm38) splice site probably null
R3104:Ccdc191 UTSW 16 43,931,210 (GRCm38) missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43,931,210 (GRCm38) missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43,931,210 (GRCm38) missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43,947,509 (GRCm38) missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43,947,509 (GRCm38) missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43,947,509 (GRCm38) missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43,947,509 (GRCm38) missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43,931,283 (GRCm38) missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43,939,173 (GRCm38) splice site probably benign
R4788:Ccdc191 UTSW 16 43,956,822 (GRCm38) missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43,943,505 (GRCm38) missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43,908,613 (GRCm38) missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43,915,485 (GRCm38) missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43,947,457 (GRCm38) nonsense probably null
R7543:Ccdc191 UTSW 16 43,898,209 (GRCm38) nonsense probably null
R7843:Ccdc191 UTSW 16 43,959,336 (GRCm38) missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43,915,605 (GRCm38) critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43,889,899 (GRCm38) start gained probably benign
R8984:Ccdc191 UTSW 16 43,890,218 (GRCm38) intron probably benign
R8987:Ccdc191 UTSW 16 43,931,347 (GRCm38) missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43,898,149 (GRCm38) missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43,905,468 (GRCm38) missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43,943,678 (GRCm38) nonsense probably null
R9448:Ccdc191 UTSW 16 43,938,975 (GRCm38) missense
R9507:Ccdc191 UTSW 16 43,943,829 (GRCm38) missense probably damaging 0.99
R9757:Ccdc191 UTSW 16 43,941,807 (GRCm38) missense
Z1177:Ccdc191 UTSW 16 43,939,122 (GRCm38) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCACCTACTGGGCTGTTTGTCAAAG -3'
(R):5'- GCACTGATGCACTGACCTGAACAC -3'

Sequencing Primer
(F):5'- tttaaaaaaaGTCACCCAACTCTGG -3'
(R):5'- ctctctctctctcctctctctc -3'
Posted On 2013-11-08