Mutagenetix > Incidental Mutations

Incidental Mutation 'R0908:Pde5a'

83384

Institutional Source

Beutler Lab

Gene Symbol

Pde5a

Ensembl Gene

ENSMUSG00000053965

Gene Name

phosphodiesterase 5A, cGMP-specific

Synonyms

PDE5A1, Pde5

MMRRC Submission

039066-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.405) question?

Stock #

R0908 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122728947-122859374 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122779001 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 344 (I344L)

Ref Sequence

ENSEMBL: ENSMUSP00000069011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066728] [ENSMUST00000200389]

PDB Structure

Solution Structure of cGMP-binding GAF domain of Phosphodiesterase 5 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000066728
AA Change: I344L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000069011
Gene: ENSMUSG00000053965
AA Change: I344L

Domain	Start	End	E-Value	Type
Blast:GAF	64	152	4e-42	BLAST
GAF	154	314	2.23e-31	SMART
GAF	336	503	9.8e-28	SMART
HDc	600	768	8.11e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196290

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198314

Predicted Effect

probably benign
Transcript: ENSMUST00000200389
AA Change: I312L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000143042
Gene: ENSMUSG00000053965
AA Change: I312L

Domain	Start	End	E-Value	Type
Blast:GAF	32	120	3e-42	BLAST
GAF	122	282	1.1e-33	SMART
GAF	304	471	4.7e-30	SMART
HDc	568	736	4.4e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200530

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cGMP-binding, cGMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family. This phosphodiesterase specifically hydrolyzes cGMP to 5'-GMP. It is involved in the regulation of intracellular concentrations of cyclic nucleotides and is important for smooth muscle relaxation in the cardiovascular system. Alternative splicing of this gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,070,077	F1676I	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Atp8b3	T	C	10: 80,520,084	T1265A	probably benign	Het
Cep112	T	C	11: 108,664,497	V679A	possibly damaging	Het
Cts8	A	T	13: 61,250,916	Y259N	probably damaging	Het
Depdc7	A	G	2: 104,728,092	S195P	probably benign	Het
Dio2	A	T	12: 90,729,648	C189S	probably damaging	Het
Dmc1	A	G	15: 79,585,689	L189P	probably damaging	Het
Ehmt1	A	G	2: 24,804,888	Y1016H	probably damaging	Het
Gle1	T	C	2: 29,936,121	S71P	probably benign	Het
Gykl1	T	A	18: 52,695,369	*550K	probably null	Het
Klhl32	T	C	4: 24,682,092	D197G	probably damaging	Het
Krt78	G	A	15: 101,950,901	T287M	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Mrpl1	A	T	5: 96,262,083	I272L	probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Olfr596	T	C	7: 103,310,573	V284A	possibly damaging	Het
Olfr937	T	C	9: 39,059,947	T240A	probably damaging	Het
Pak3	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	X: 143,743,893		probably benign	Het
Prl7c1	A	G	13: 27,773,734	I241T	possibly damaging	Het
Rp1	T	C	1: 4,344,655	E2078G	probably benign	Het
Scamp3	T	C	3: 89,179,439		probably null	Het
Sept8	A	G	11: 53,537,870	H414R	probably benign	Het
Spata5	T	A	3: 37,431,623		probably null	Het
Spef2	T	A	15: 9,614,195		probably null	Het
Txlnb	A	G	10: 17,799,177	N26S	probably damaging	Het
Vmn1r11	G	T	6: 57,138,064	V201L	probably damaging	Het

Other mutations in Pde5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Pde5a	APN	3	122794357	missense	probably damaging	1.00
IGL00945:Pde5a	APN	3	122835642	critical splice donor site	probably null
IGL01395:Pde5a	APN	3	122817955	missense	probably benign	0.40
IGL01872:Pde5a	APN	3	122794369	critical splice donor site	probably null
IGL01947:Pde5a	APN	3	122835610	missense	probably damaging	1.00
IGL02033:Pde5a	APN	3	122803061	missense	possibly damaging	0.51
IGL02209:Pde5a	APN	3	122825015	splice site	probably benign
IGL02220:Pde5a	APN	3	122748382	missense	probably benign	0.05
IGL02301:Pde5a	APN	3	122760885	missense	probably damaging	1.00
IGL02748:Pde5a	APN	3	122760892	missense	probably damaging	0.99
R0009:Pde5a	UTSW	3	122824902	splice site	probably benign
R0031:Pde5a	UTSW	3	122803055	missense	probably benign	0.00
R0119:Pde5a	UTSW	3	122748458	missense	probably damaging	1.00
R0390:Pde5a	UTSW	3	122835583	missense	probably damaging	1.00
R0481:Pde5a	UTSW	3	122818077	splice site	probably benign
R0499:Pde5a	UTSW	3	122748458	missense	probably damaging	1.00
R0657:Pde5a	UTSW	3	122748458	missense	probably damaging	1.00
R0845:Pde5a	UTSW	3	122729331	missense	probably benign	0.28
R1147:Pde5a	UTSW	3	122794313	missense	probably damaging	1.00
R1147:Pde5a	UTSW	3	122794313	missense	probably damaging	1.00
R1553:Pde5a	UTSW	3	122778936	missense	probably benign	0.14
R1728:Pde5a	UTSW	3	122748240	missense	probably damaging	1.00
R1744:Pde5a	UTSW	3	122747897	missense	probably damaging	0.97
R1774:Pde5a	UTSW	3	122729364	missense	probably benign	0.01
R1784:Pde5a	UTSW	3	122748240	missense	probably damaging	1.00
R2437:Pde5a	UTSW	3	122843053	missense	probably damaging	1.00
R2844:Pde5a	UTSW	3	122851708	missense	probably damaging	1.00
R2897:Pde5a	UTSW	3	122779002	missense	probably benign	0.03
R2936:Pde5a	UTSW	3	122794319	missense	probably damaging	0.97
R3160:Pde5a	UTSW	3	122781628	nonsense	probably null
R3162:Pde5a	UTSW	3	122781628	nonsense	probably null
R3704:Pde5a	UTSW	3	122779019	missense	probably benign	0.00
R3847:Pde5a	UTSW	3	122803160	missense	probably damaging	0.98
R3932:Pde5a	UTSW	3	122760896	missense	probably damaging	0.98
R4387:Pde5a	UTSW	3	122729352	missense	probably benign	0.00
R4613:Pde5a	UTSW	3	122823093	missense	probably damaging	1.00
R4676:Pde5a	UTSW	3	122747893	missense	possibly damaging	0.67
R5034:Pde5a	UTSW	3	122852586	missense	probably damaging	1.00
R5034:Pde5a	UTSW	3	122852587	missense	probably damaging	1.00
R5358:Pde5a	UTSW	3	122748176	missense	probably damaging	1.00
R5394:Pde5a	UTSW	3	122818009	missense	probably damaging	1.00
R5502:Pde5a	UTSW	3	122803032	missense	probably damaging	1.00
R5821:Pde5a	UTSW	3	122817955	missense	probably benign	0.40
R5932:Pde5a	UTSW	3	122841044	missense	probably benign	0.01
R6063:Pde5a	UTSW	3	122824925	missense	probably benign	0.23
R6190:Pde5a	UTSW	3	122729307	missense	probably benign	0.28
R6815:Pde5a	UTSW	3	122824924	missense	probably benign	0.01
R6940:Pde5a	UTSW	3	122779032	missense	possibly damaging	0.53
R7274:Pde5a	UTSW	3	122855246	nonsense	probably null
R7337:Pde5a	UTSW	3	122748458	missense	probably damaging	1.00
R7384:Pde5a	UTSW	3	122825000	missense	probably damaging	1.00
R7480:Pde5a	UTSW	3	122803148	missense	possibly damaging	0.50
R7508:Pde5a	UTSW	3	122818030	missense	probably damaging	1.00
R7522:Pde5a	UTSW	3	122840999	nonsense	probably null
R7623:Pde5a	UTSW	3	122774601	missense	probably benign
R8153:Pde5a	UTSW	3	122852576	missense	probably benign	0.30
R8153:Pde5a	UTSW	3	122852578	missense	probably damaging	1.00
R8351:Pde5a	UTSW	3	122748479	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCGTAAACGTGCTCACCAACAG -3'
(R):5'- TGCACAGTGCTATACAGGGTGTTTC -3'

Sequencing Primer
(F):5'- GTGCTCACCAACAGCCTTTAG -3'
(R):5'- CACCGAAGGCTCTTGCTAC -3'

Posted On

2013-11-08