Mutagenetix > Incidental Mutations

Incidental Mutation 'R0908:Klhl32'

83386

Institutional Source

Beutler Lab

Gene Symbol

Klhl32

Ensembl Gene

ENSMUSG00000040387

Gene Name

kelch-like 32

Synonyms

LOC384000, D4Ertd389e, 6430524H05Rik

MMRRC Submission

039066-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R0908 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24612554-24851124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24682092 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 197 (D197G)

Ref Sequence

ENSEMBL: ENSMUSP00000103853 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084781] [ENSMUST00000108214] [ENSMUST00000108218] [ENSMUST00000140652] [ENSMUST00000150920]

Predicted Effect

probably damaging
Transcript: ENSMUST00000084781
AA Change: D164G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000081839
Gene: ENSMUSG00000040387
AA Change: D164G

Domain	Start	End	E-Value	Type
BTB	42	138	1.28e-22	SMART
BACK	111	212	3.17e-22	SMART
Kelch	257	313	4.07e-1	SMART
Kelch	314	365	3.57e-1	SMART
Kelch	366	413	3.77e-4	SMART
Kelch	414	461	7.04e-4	SMART
Kelch	462	514	6.47e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108213

Predicted Effect

probably damaging
Transcript: ENSMUST00000108214
AA Change: D197G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000103849
Gene: ENSMUSG00000040387
AA Change: D197G

Domain	Start	End	E-Value	Type
BTB	42	139	2.86e-25	SMART
BACK	144	225	3.31e-2	SMART
Blast:Kelch	233	285	1e-31	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000108218
AA Change: D197G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103853
Gene: ENSMUSG00000040387
AA Change: D197G

Domain	Start	End	E-Value	Type
BTB	42	139	2.86e-25	SMART
BACK	144	245	3.17e-22	SMART
Kelch	290	346	4.07e-1	SMART
Kelch	347	398	3.57e-1	SMART
Kelch	399	446	3.77e-4	SMART
Kelch	447	494	7.04e-4	SMART
Kelch	495	547	6.47e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140652

SMART Domains

Protein: ENSMUSP00000137312
Gene: ENSMUSG00000040387

Domain	Start	End	E-Value	Type
BTB	42	139	2.14e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150920

SMART Domains

Protein: ENSMUSP00000135917
Gene: ENSMUSG00000040387

Domain	Start	End	E-Value	Type
Blast:BTB	1	49	4e-19	BLAST

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,070,077	F1676I	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Atp8b3	T	C	10: 80,520,084	T1265A	probably benign	Het
Cep112	T	C	11: 108,664,497	V679A	possibly damaging	Het
Cts8	A	T	13: 61,250,916	Y259N	probably damaging	Het
Depdc7	A	G	2: 104,728,092	S195P	probably benign	Het
Dio2	A	T	12: 90,729,648	C189S	probably damaging	Het
Dmc1	A	G	15: 79,585,689	L189P	probably damaging	Het
Ehmt1	A	G	2: 24,804,888	Y1016H	probably damaging	Het
Gle1	T	C	2: 29,936,121	S71P	probably benign	Het
Gykl1	T	A	18: 52,695,369	*550K	probably null	Het
Krt78	G	A	15: 101,950,901	T287M	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Mrpl1	A	T	5: 96,262,083	I272L	probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Olfr596	T	C	7: 103,310,573	V284A	possibly damaging	Het
Olfr937	T	C	9: 39,059,947	T240A	probably damaging	Het
Pak3	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	X: 143,743,893		probably benign	Het
Pde5a	A	T	3: 122,779,001	I344L	probably benign	Het
Prl7c1	A	G	13: 27,773,734	I241T	possibly damaging	Het
Rp1	T	C	1: 4,344,655	E2078G	probably benign	Het
Scamp3	T	C	3: 89,179,439		probably null	Het
Sept8	A	G	11: 53,537,870	H414R	probably benign	Het
Spata5	T	A	3: 37,431,623		probably null	Het
Spef2	T	A	15: 9,614,195		probably null	Het
Txlnb	A	G	10: 17,799,177	N26S	probably damaging	Het
Vmn1r11	G	T	6: 57,138,064	V201L	probably damaging	Het

Other mutations in Klhl32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Klhl32	APN	4	24682245	missense	probably damaging	1.00
IGL02293:Klhl32	APN	4	24626935	missense	probably damaging	1.00
IGL02374:Klhl32	APN	4	24743856	critical splice donor site	probably null
IGL02824:Klhl32	APN	4	24682237	nonsense	probably null
IGL03211:Klhl32	APN	4	24792616	critical splice donor site	probably null
IGL03374:Klhl32	APN	4	24649533	intron	probably benign
R0071:Klhl32	UTSW	4	24743907	missense	probably damaging	0.98
R0478:Klhl32	UTSW	4	24792777	missense	probably damaging	1.00
R0856:Klhl32	UTSW	4	24682092	missense	probably damaging	1.00
R1882:Klhl32	UTSW	4	24743916	nonsense	probably null
R1927:Klhl32	UTSW	4	24617474	missense	probably benign	0.00
R2137:Klhl32	UTSW	4	24629275	nonsense	probably null
R3176:Klhl32	UTSW	4	24682063	missense	probably benign	0.39
R3276:Klhl32	UTSW	4	24682063	missense	probably benign	0.39
R4059:Klhl32	UTSW	4	24792781	missense	probably damaging	1.00
R4246:Klhl32	UTSW	4	24800822	missense	possibly damaging	0.50
R4597:Klhl32	UTSW	4	24629339	missense	probably benign	0.21
R4801:Klhl32	UTSW	4	24649698	missense	possibly damaging	0.82
R4802:Klhl32	UTSW	4	24649698	missense	possibly damaging	0.82
R4929:Klhl32	UTSW	4	24709030	missense	probably damaging	1.00
R5654:Klhl32	UTSW	4	24800805	critical splice donor site	probably null
R6039:Klhl32	UTSW	4	24792615	critical splice donor site	probably null
R6039:Klhl32	UTSW	4	24792615	critical splice donor site	probably null
R6362:Klhl32	UTSW	4	24629195	missense	probably null	1.00
R6490:Klhl32	UTSW	4	24711578	intron	probably benign
R6948:Klhl32	UTSW	4	24629250	missense	probably benign	0.00
R6981:Klhl32	UTSW	4	24709030	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTAGCCTTCAGTGACTTGCTTAAC -3'
(R):5'- GGTCCTAATACTAATGGCCCCATCCC -3'

Sequencing Primer
(F):5'- CAGTGACTTGCTTAACTAGGGAG -3'
(R):5'- CCCGTGCCTGTTATAAAAACAGTG -3'

Posted On

2013-11-08