Incidental Mutation 'R0908:Mrpl1'
ID83387
Institutional Source Beutler Lab
Gene Symbol Mrpl1
Ensembl Gene ENSMUSG00000029486
Gene Namemitochondrial ribosomal protein L1
Synonyms5830418D04Rik, 2410002L03Rik
MMRRC Submission 039066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0908 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location96209493-96266727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96262083 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 272 (I272L)
Ref Sequence ENSEMBL: ENSMUSP00000112977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036437] [ENSMUST00000117766]
Predicted Effect probably benign
Transcript: ENSMUST00000036437
AA Change: I272L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000037046
Gene: ENSMUSG00000029486
AA Change: I272L

DomainStartEndE-ValueType
Pfam:MRL1 2 165 1.3e-56 PFAM
Pfam:Ribosomal_L1 55 307 3e-17 PFAM
low complexity region 318 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117766
AA Change: I272L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112977
Gene: ENSMUSG00000029486
AA Change: I272L

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 55 307 3.1e-18 PFAM
low complexity region 318 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L1 ribosomal protein family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp8b3 T C 10: 80,520,084 T1265A probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dio2 A T 12: 90,729,648 C189S probably damaging Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Olfr937 T C 9: 39,059,947 T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Vmn1r11 G T 6: 57,138,064 V201L probably damaging Het
Other mutations in Mrpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Mrpl1 APN 5 96226285 missense probably damaging 1.00
IGL01068:Mrpl1 APN 5 96224036 splice site probably benign
IGL02172:Mrpl1 APN 5 96231715 missense probably damaging 0.96
R1726:Mrpl1 UTSW 5 96223827 missense probably benign 0.00
R1827:Mrpl1 UTSW 5 96226343 missense possibly damaging 0.55
R4387:Mrpl1 UTSW 5 96238919 missense possibly damaging 0.48
R4636:Mrpl1 UTSW 5 96210175 missense probably benign 0.04
R5974:Mrpl1 UTSW 5 96231794 critical splice donor site probably null
R7062:Mrpl1 UTSW 5 96213791 missense probably benign 0.16
Z1088:Mrpl1 UTSW 5 96262069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCGGGAAATTACTTGGAAACTGC -3'
(R):5'- AGAAGGCCAACTGGCTTCAAACTAC -3'

Sequencing Primer
(F):5'- GAAAAACTTAAAAACAGTCCACTGTG -3'
(R):5'- TATGCAAATGTACAAAGGTTCGAGG -3'
Posted On2013-11-08