Incidental Mutation 'R0908:Atp8b3'
ID 83397
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission 039066-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R0908 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80355918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1265 (T1265A)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000051773] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: T1265A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: T1265A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051773
SMART Domains Protein: ENSMUSP00000053288
Gene: ENSMUSG00000045518

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 56 76 N/A INTRINSIC
low complexity region 98 116 N/A INTRINSIC
low complexity region 126 151 N/A INTRINSIC
low complexity region 190 227 N/A INTRINSIC
CUT 310 395 1.24e-42 SMART
HOX 411 473 1.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 137,775,838 (GRCm39) F1676I probably damaging Het
Afg2a T A 3: 37,485,772 (GRCm39) probably null Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Cep112 T C 11: 108,555,323 (GRCm39) V679A possibly damaging Het
Cts8 A T 13: 61,398,730 (GRCm39) Y259N probably damaging Het
Depdc7 A G 2: 104,558,437 (GRCm39) S195P probably benign Het
Dio2 A T 12: 90,696,422 (GRCm39) C189S probably damaging Het
Dmc1 A G 15: 79,469,890 (GRCm39) L189P probably damaging Het
Ehmt1 A G 2: 24,694,900 (GRCm39) Y1016H probably damaging Het
Gle1 T C 2: 29,826,133 (GRCm39) S71P probably benign Het
Gykl1 T A 18: 52,828,441 (GRCm39) *550K probably null Het
Klhl32 T C 4: 24,682,092 (GRCm39) D197G probably damaging Het
Krt78 G A 15: 101,859,336 (GRCm39) T287M probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Mrpl1 A T 5: 96,409,942 (GRCm39) I272L probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Or52e19 T C 7: 102,959,780 (GRCm39) V284A possibly damaging Het
Or8g23 T C 9: 38,971,243 (GRCm39) T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 142,526,889 (GRCm39) probably benign Het
Pde5a A T 3: 122,572,650 (GRCm39) I344L probably benign Het
Prl7c1 A G 13: 27,957,717 (GRCm39) I241T possibly damaging Het
Rp1 T C 1: 4,414,878 (GRCm39) E2078G probably benign Het
Scamp3 T C 3: 89,086,746 (GRCm39) probably null Het
Septin8 A G 11: 53,428,697 (GRCm39) H414R probably benign Het
Spef2 T A 15: 9,614,281 (GRCm39) probably null Het
Txlnb A G 10: 17,674,925 (GRCm39) N26S probably damaging Het
Vmn1r11 G T 6: 57,115,049 (GRCm39) V201L probably damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGTTGCATTGTCCTGGATGACTG -3'
(R):5'- AGTCTGTGAATCCCTGAACCCACC -3'

Sequencing Primer
(F):5'- TCCTGGATGACTGGGAATCTCC -3'
(R):5'- CCCGAAGAAGACATTCCCTTG -3'
Posted On 2013-11-08