Incidental Mutation 'R0908:Sept8'
ID83398
Institutional Source Beutler Lab
Gene Symbol Sept8
Ensembl Gene ENSMUSG00000018398
Gene Nameseptin 8
SynonymsSepl
MMRRC Submission 039066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0908 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53519257-53549565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53537870 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 414 (H414R)
Ref Sequence ENSEMBL: ENSMUSP00000120427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108987] [ENSMUST00000117061] [ENSMUST00000120878] [ENSMUST00000121334] [ENSMUST00000142800] [ENSMUST00000147912]
Predicted Effect probably benign
Transcript: ENSMUST00000108987
AA Change: H414R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104615
Gene: ENSMUSG00000018398
AA Change: H414R

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-101 PFAM
Pfam:MMR_HSR1 46 191 5.7e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117061
AA Change: H414R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112920
Gene: ENSMUSG00000018398
AA Change: H414R

DomainStartEndE-ValueType
Pfam:Septin 41 314 6.5e-101 PFAM
Pfam:MMR_HSR1 46 191 1.3e-6 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120878
AA Change: H412R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113775
Gene: ENSMUSG00000018398
AA Change: H412R

DomainStartEndE-ValueType
Pfam:Septin 41 312 6.4e-98 PFAM
Pfam:MMR_HSR1 46 190 6.3e-7 PFAM
low complexity region 349 372 N/A INTRINSIC
low complexity region 377 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121334
AA Change: H414R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113038
Gene: ENSMUSG00000018398
AA Change: H414R

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-100 PFAM
Pfam:MMR_HSR1 46 187 2.6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142800
SMART Domains Protein: ENSMUSP00000124057
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 1 51 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145927
Predicted Effect probably benign
Transcript: ENSMUST00000147912
AA Change: H414R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120427
Gene: ENSMUSG00000018398
AA Change: H414R

DomainStartEndE-ValueType
Pfam:Septin 41 314 2.1e-101 PFAM
Pfam:MMR_HSR1 46 190 6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit myelin outfoldings and reduced nerve conduction velocity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp8b3 T C 10: 80,520,084 T1265A probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dio2 A T 12: 90,729,648 C189S probably damaging Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mrpl1 A T 5: 96,262,083 I272L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Olfr937 T C 9: 39,059,947 T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Vmn1r11 G T 6: 57,138,064 V201L probably damaging Het
Other mutations in Sept8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept8 APN 11 53531996 missense probably benign 0.08
IGL01649:Sept8 APN 11 53535028 missense possibly damaging 0.79
IGL02131:Sept8 APN 11 53537857 missense possibly damaging 0.79
IGL02547:Sept8 APN 11 53537265 missense probably damaging 1.00
R0856:Sept8 UTSW 11 53537870 missense probably benign 0.01
R1799:Sept8 UTSW 11 53534483 missense probably benign 0.32
R3774:Sept8 UTSW 11 53537579 missense probably damaging 1.00
R4747:Sept8 UTSW 11 53536718 missense probably damaging 1.00
R4810:Sept8 UTSW 11 53534589 missense probably damaging 0.97
R5034:Sept8 UTSW 11 53534438 missense probably damaging 1.00
R5313:Sept8 UTSW 11 53535982 missense probably damaging 1.00
R5652:Sept8 UTSW 11 53537217 missense probably damaging 1.00
R6263:Sept8 UTSW 11 53548383 missense probably benign 0.00
R6285:Sept8 UTSW 11 53534767 intron probably null
R6289:Sept8 UTSW 11 53534478 missense probably damaging 0.99
R6571:Sept8 UTSW 11 53537163 missense probably damaging 1.00
R7238:Sept8 UTSW 11 53536692 missense possibly damaging 0.68
R7249:Sept8 UTSW 11 53535122 missense probably damaging 0.97
X0024:Sept8 UTSW 11 53536724 nonsense probably null
X0058:Sept8 UTSW 11 53535085 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCAGGCAGAGGCTGGTGG -3'
(R):5'- ACAGTGAGCGTGAGGCTGGG -3'

Sequencing Primer
(F):5'- AGTTCCTAAGCGAGCTGC -3'
(R):5'- tgagggggtgagaagtgag -3'
Posted On2013-11-08