Incidental Mutation 'R0908:Gykl1'
ID83409
Institutional Source Beutler Lab
Gene Symbol Gykl1
Ensembl Gene ENSMUSG00000053624
Gene Nameglycerol kinase-like 1
SynonymsGk-rs1
MMRRC Submission 039066-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R0908 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location52693679-52695668 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 52695369 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 550 (*550K)
Ref Sequence ENSEMBL: ENSMUSP00000067598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066193]
Predicted Effect probably null
Transcript: ENSMUST00000066193
AA Change: *550K
SMART Domains Protein: ENSMUSP00000067598
Gene: ENSMUSG00000053624
AA Change: *550K

DomainStartEndE-ValueType
Pfam:FGGY_N 12 266 6.8e-90 PFAM
Pfam:FGGY_C 275 467 4.2e-66 PFAM
transmembrane domain 524 546 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FGGY kinase family. This protein is a key enzyme in the regulation of glycerol uptake and metabolism. It catalyzes the phosphorylation of glycerol by ATP, yielding ADP and glycerol-3-phosphate. Mutations in this gene are associated with glycerol kinase deficiency (GKD). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp8b3 T C 10: 80,520,084 T1265A probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dio2 A T 12: 90,729,648 C189S probably damaging Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mrpl1 A T 5: 96,262,083 I272L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Olfr937 T C 9: 39,059,947 T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Vmn1r11 G T 6: 57,138,064 V201L probably damaging Het
Other mutations in Gykl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Gykl1 APN 18 52694736 missense possibly damaging 0.94
IGL02694:Gykl1 APN 18 52694185 missense probably benign 0.00
R0689:Gykl1 UTSW 18 52694051 missense possibly damaging 0.90
R0856:Gykl1 UTSW 18 52695369 makesense probably null
R1428:Gykl1 UTSW 18 52694761 missense probably benign 0.00
R2229:Gykl1 UTSW 18 52695267 missense probably benign 0.00
R5307:Gykl1 UTSW 18 52694651 missense possibly damaging 0.67
R5696:Gykl1 UTSW 18 52694195 missense probably benign 0.02
R6278:Gykl1 UTSW 18 52695208 missense probably benign 0.06
R8804:Gykl1 UTSW 18 52694536 missense probably benign 0.00
RF040:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF041:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF042:Gykl1 UTSW 18 52694416 missense probably benign 0.06
RF044:Gykl1 UTSW 18 52694416 missense probably benign 0.06
Z1088:Gykl1 UTSW 18 52694165 nonsense probably null
Z1176:Gykl1 UTSW 18 52694547 missense probably damaging 1.00
Z1177:Gykl1 UTSW 18 52695132 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGTCGTTACGCCACATGGAAGAAAG -3'
(R):5'- ACTTGGTCACCACCAGCGAAAATG -3'

Sequencing Primer
(F):5'- AGCTGTGCTGAAGTCAATGG -3'
(R):5'- CCAGCGAAAATGGTCAATATTTAAAG -3'
Posted On2013-11-08