Incidental Mutation 'R0909:Mrpl44'
ID83412
Institutional Source Beutler Lab
Gene Symbol Mrpl44
Ensembl Gene ENSMUSG00000026248
Gene Namemitochondrial ribosomal protein L44
Synonyms1810030E18Rik, 5730593H20Rik
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location79776018-79781445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79779653 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 272 (V272I)
Ref Sequence ENSEMBL: ENSMUSP00000027464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027464] [ENSMUST00000143368]
Predicted Effect probably benign
Transcript: ENSMUST00000027464
AA Change: V272I

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027464
Gene: ENSMUSG00000026248
AA Change: V272I

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
PDB:4CE4|H 67 333 1e-160 PDB
SCOP:d1jfza_ 72 224 5e-23 SMART
Blast:RIBOc 86 228 2e-90 BLAST
Blast:DSRM 237 288 6e-8 BLAST
SCOP:d1di2a_ 237 304 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143368
SMART Domains Protein: ENSMUSP00000123303
Gene: ENSMUSG00000073643

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
Blast:WD40 145 182 6e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189176
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Mrpl44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Mrpl44 APN 1 79781004 missense probably benign 0.01
IGL02633:Mrpl44 APN 1 79776145 missense probably benign 0.02
R0054:Mrpl44 UTSW 1 79779495 missense probably damaging 1.00
R0054:Mrpl44 UTSW 1 79779495 missense probably damaging 1.00
R1180:Mrpl44 UTSW 1 79777960 missense probably damaging 0.99
R1347:Mrpl44 UTSW 1 79777952 missense probably damaging 1.00
R1347:Mrpl44 UTSW 1 79777952 missense probably damaging 1.00
R1448:Mrpl44 UTSW 1 79777960 missense probably damaging 0.99
R3689:Mrpl44 UTSW 1 79779649 nonsense probably null
R3690:Mrpl44 UTSW 1 79779649 nonsense probably null
R4533:Mrpl44 UTSW 1 79776254 missense possibly damaging 0.91
R4818:Mrpl44 UTSW 1 79780977 missense probably benign 0.00
R4893:Mrpl44 UTSW 1 79777865 missense probably damaging 0.97
R6178:Mrpl44 UTSW 1 79778178 missense possibly damaging 0.76
X0018:Mrpl44 UTSW 1 79778075 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGCGAAAAGTTTCAGATTCCGAGCAT -3'
(R):5'- AGATAATGACCCTATCCACCCTGCC -3'

Sequencing Primer
(F):5'- CAGATTCCGAGCATTTTGGATTTTC -3'
(R):5'- ctgcttgcctccacctc -3'
Posted On2013-11-08