Incidental Mutation 'R0909:Noxa1'
ID83413
Institutional Source Beutler Lab
Gene Symbol Noxa1
Ensembl Gene ENSMUSG00000036805
Gene NameNADPH oxidase activator 1
Synonyms
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25085667-25095149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25091794 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 99 (L99Q)
Ref Sequence ENSEMBL: ENSMUSP00000110014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044018] [ENSMUST00000114373]
Predicted Effect probably damaging
Transcript: ENSMUST00000044018
AA Change: L99Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037423
Gene: ENSMUSG00000036805
AA Change: L99Q

DomainStartEndE-ValueType
TPR 38 71 8.17e-1 SMART
TPR 72 105 1.47e-2 SMART
TPR 122 155 1.97e1 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
PB1 285 365 6.76e-9 SMART
SH3 372 427 1.81e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114373
AA Change: L99Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110014
Gene: ENSMUSG00000036805
AA Change: L99Q

DomainStartEndE-ValueType
TPR 38 71 8.17e-1 SMART
TPR 72 105 1.47e-2 SMART
TPR 122 155 1.97e1 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
PB1 277 357 6.76e-9 SMART
SH3 364 419 1.81e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which activates NADPH oxidases, enzymes which catalyze a reaction generating reactive oxygen species. The encoded protein contains four N-terminal tetratricopeptide domains and a C-terminal Src homology 3 domain. Interaction between the encoded protein and proteins in the oxidase regulatory complex occur via the tetratricopeptide domains. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted allele removing exons 3 through 6 exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Noxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Noxa1 APN 2 25094902 missense probably benign 0.37
IGL01316:Noxa1 APN 2 25086011 missense probably benign 0.22
IGL02274:Noxa1 APN 2 25085755 missense probably benign 0.15
IGL02528:Noxa1 APN 2 25090633 unclassified probably benign
IGL02952:Noxa1 APN 2 25091761 missense probably damaging 1.00
IGL03286:Noxa1 APN 2 25085720 splice site probably null
IGL03330:Noxa1 APN 2 25090514 missense possibly damaging 0.48
R0322:Noxa1 UTSW 2 25092554 missense probably damaging 1.00
R0357:Noxa1 UTSW 2 25085850 missense probably damaging 1.00
R0636:Noxa1 UTSW 2 25086094 unclassified probably benign
R1459:Noxa1 UTSW 2 25092546 missense probably benign 0.06
R1702:Noxa1 UTSW 2 25092584 missense probably damaging 1.00
R1958:Noxa1 UTSW 2 25090608 missense probably damaging 0.99
R4618:Noxa1 UTSW 2 25091749 missense probably damaging 1.00
R5104:Noxa1 UTSW 2 25086234 missense probably benign 0.18
R5606:Noxa1 UTSW 2 25086280 missense possibly damaging 0.67
R5619:Noxa1 UTSW 2 25085976 missense probably damaging 0.99
R5826:Noxa1 UTSW 2 25086241 missense probably damaging 0.98
R6076:Noxa1 UTSW 2 25085809 missense probably damaging 1.00
R6920:Noxa1 UTSW 2 25091832 splice site probably null
R8112:Noxa1 UTSW 2 25092541 critical splice donor site probably null
X0021:Noxa1 UTSW 2 25090214 missense possibly damaging 0.95
X0025:Noxa1 UTSW 2 25090491 critical splice donor site probably null
Z1176:Noxa1 UTSW 2 25090273 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAAAGGTGACAAGCCCTGGCAGAC -3'
(R):5'- CCATGAAGGTGACTGCTATTGCCTC -3'

Sequencing Primer
(F):5'- GGCCCTTATTGCAAATCAGG -3'
(R):5'- TCCAGGTCTCCCAGAGCTG -3'
Posted On2013-11-08