Incidental Mutation 'R0909:Ttc16'
ID83414
Institutional Source Beutler Lab
Gene Symbol Ttc16
Ensembl Gene ENSMUSG00000039021
Gene Nametetratricopeptide repeat domain 16
Synonyms1200002K10Rik
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32757026-32775633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32762868 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 593 (T593A)
Ref Sequence ENSEMBL: ENSMUSP00000123927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009707] [ENSMUST00000066478] [ENSMUST00000091059] [ENSMUST00000125891] [ENSMUST00000156617] [ENSMUST00000161089] [ENSMUST00000161430] [ENSMUST00000161950] [ENSMUST00000177382] [ENSMUST00000175763]
Predicted Effect probably benign
Transcript: ENSMUST00000009707
SMART Domains Protein: ENSMUSP00000009707
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 160 1.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066478
AA Change: T593A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068977
Gene: ENSMUSG00000039021
AA Change: T593A

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091059
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123624
Predicted Effect probably benign
Transcript: ENSMUST00000125891
Predicted Effect probably benign
Transcript: ENSMUST00000140999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149987
Predicted Effect probably benign
Transcript: ENSMUST00000156617
SMART Domains Protein: ENSMUSP00000122251
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161089
AA Change: T593A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124915
Gene: ENSMUSG00000039021
AA Change: T593A

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161430
AA Change: T650A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124031
Gene: ENSMUSG00000039021
AA Change: T650A

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 596 611 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
low complexity region 782 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161950
AA Change: T593A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123927
Gene: ENSMUSG00000039021
AA Change: T593A

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177382
SMART Domains Protein: ENSMUSP00000134968
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Torsin 35 101 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175763
SMART Domains Protein: ENSMUSP00000135701
Gene: ENSMUSG00000009563

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Ttc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ttc16 APN 2 32770247 missense probably damaging 1.00
IGL02931:Ttc16 APN 2 32771927 missense probably damaging 1.00
IGL03143:Ttc16 APN 2 32774445 missense possibly damaging 0.86
IGL03206:Ttc16 APN 2 32771885 splice site probably null
IGL03310:Ttc16 APN 2 32762397 unclassified probably benign
P0033:Ttc16 UTSW 2 32762574 missense probably benign 0.00
R1085:Ttc16 UTSW 2 32775080 missense possibly damaging 0.83
R1659:Ttc16 UTSW 2 32762535 missense probably benign 0.15
R1752:Ttc16 UTSW 2 32772150 missense probably damaging 0.96
R2408:Ttc16 UTSW 2 32768008 missense probably benign 0.00
R3835:Ttc16 UTSW 2 32769310 missense probably damaging 0.99
R4576:Ttc16 UTSW 2 32770059 missense probably benign 0.02
R4590:Ttc16 UTSW 2 32773741 missense probably damaging 1.00
R4630:Ttc16 UTSW 2 32775377 start gained probably benign
R5081:Ttc16 UTSW 2 32767976 missense probably damaging 1.00
R5128:Ttc16 UTSW 2 32762997 missense probably benign 0.31
R5642:Ttc16 UTSW 2 32775336 missense probably damaging 0.99
R5704:Ttc16 UTSW 2 32769125 missense probably damaging 1.00
R6384:Ttc16 UTSW 2 32767549 missense probably damaging 1.00
R6723:Ttc16 UTSW 2 32768037 missense possibly damaging 0.66
R7103:Ttc16 UTSW 2 32774428 missense probably benign 0.00
R7295:Ttc16 UTSW 2 32774425 missense probably null 0.02
R7570:Ttc16 UTSW 2 32768968 missense probably damaging 1.00
R7982:Ttc16 UTSW 2 32775035 intron probably benign
R8074:Ttc16 UTSW 2 32774123 unclassified probably benign
Z1088:Ttc16 UTSW 2 32769333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACGCTCAGGGTAGACCTGGAC -3'
(R):5'- CCACAGCCCAGACATATTGAGAAGG -3'

Sequencing Primer
(F):5'- TAGACCTGGACTTGCTAGGC -3'
(R):5'- AGGCTGTCCAGAAGTTCTGTC -3'
Posted On2013-11-08