Incidental Mutation 'R0909:Nr6a1'
ID83415
Institutional Source Beutler Lab
Gene Symbol Nr6a1
Ensembl Gene ENSMUSG00000063972
Gene Namenuclear receptor subfamily 6, group A, member 1
Synonyms1700113M01Rik, Gcnf, NCNF
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0909 (G1)
Quality Score218
Status Not validated
Chromosome2
Chromosomal Location38723370-38927688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38885206 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 44 (D44E)
Ref Sequence ENSEMBL: ENSMUSP00000115164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076275] [ENSMUST00000112877] [ENSMUST00000142130]
Predicted Effect probably benign
Transcript: ENSMUST00000076275
AA Change: D44E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075624
Gene: ENSMUSG00000063972
AA Change: D44E

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
ZnF_C4 72 143 9.35e-36 SMART
low complexity region 202 216 N/A INTRINSIC
HOLI 304 466 3.19e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112877
AA Change: D44E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108498
Gene: ENSMUSG00000063972
AA Change: D44E

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
ZnF_C4 72 143 9.35e-36 SMART
low complexity region 202 216 N/A INTRINSIC
HOLI 304 466 3.19e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142130
AA Change: D44E

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115164
Gene: ENSMUSG00000063972
AA Change: D44E

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
ZnF_C4 57 128 9.35e-36 SMART
low complexity region 187 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an orphan nuclear receptor which is a member of the nuclear hormone receptor family. Its expression pattern suggests that it may be involved in neurogenesis and germ cell development. The protein can homodimerize and bind DNA, but in vivo targets have not been identified. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations have cardiovascular abnormalities, defective trunk development, impaired somite formation, failure to turn, open neural tube and hindgut, protrusion of the tailbud outside the yolk sac and die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Nr6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:Nr6a1 APN 2 38727889 missense probably benign 0.06
IGL02245:Nr6a1 APN 2 38740553 missense probably benign 0.04
IGL03195:Nr6a1 APN 2 38742936 missense probably damaging 1.00
R0270:Nr6a1 UTSW 2 38739020 missense possibly damaging 0.75
R1737:Nr6a1 UTSW 2 38738943 missense probably benign 0.04
R5918:Nr6a1 UTSW 2 38739091 missense probably damaging 1.00
R6210:Nr6a1 UTSW 2 38729497 missense probably damaging 0.99
R6311:Nr6a1 UTSW 2 38739071 missense possibly damaging 0.69
R6861:Nr6a1 UTSW 2 38740585 missense possibly damaging 0.71
R6978:Nr6a1 UTSW 2 38872619 missense probably benign
R7566:Nr6a1 UTSW 2 38731073 missense possibly damaging 0.77
R8177:Nr6a1 UTSW 2 38729498 missense probably benign 0.02
R8441:Nr6a1 UTSW 2 38742876 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGAGGAGGACACACAACTGGCCT -3'
(R):5'- GTCACATCCTAGCCTAAACTCTGCATC -3'

Sequencing Primer
(F):5'- gaaggaaggaaggaagggatg -3'
(R):5'- gccTAAACTCTGCATCCTCCTC -3'
Posted On2013-11-08