Incidental Mutation 'R0909:Eya2'
ID83417
Institutional Source Beutler Lab
Gene Symbol Eya2
Ensembl Gene ENSMUSG00000017897
Gene NameEYA transcriptional coactivator and phosphatase 2
Synonyms
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165595032-165771727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165754493 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 308 (N308S)
Ref Sequence ENSEMBL: ENSMUSP00000085455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063433] [ENSMUST00000088132]
Predicted Effect probably benign
Transcript: ENSMUST00000063433
AA Change: N308S

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066244
Gene: ENSMUSG00000017897
AA Change: N308S

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
PDB:4EGC|B 247 532 N/A PDB
SCOP:d1lvha_ 367 511 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088132
AA Change: N308S

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085455
Gene: ENSMUSG00000017897
AA Change: N308S

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
Pfam:Hydrolase 262 508 1.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150638
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the eyes absent protein family. The encoded protein is a tyrosine phosphatase which acts as a transcriptional activator during development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Eya2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Eya2 APN 2 165754481 missense probably damaging 1.00
IGL02368:Eya2 APN 2 165763718 missense probably damaging 1.00
IGL02465:Eya2 APN 2 165715952 missense possibly damaging 0.89
IGL02523:Eya2 APN 2 165754436 splice site probably benign
Needle UTSW 2 165763816 missense probably damaging 1.00
R0048:Eya2 UTSW 2 165716011 missense probably damaging 1.00
R0167:Eya2 UTSW 2 165716112 missense possibly damaging 0.89
R0479:Eya2 UTSW 2 165715956 nonsense probably null
R0600:Eya2 UTSW 2 165769237 missense probably damaging 1.00
R1251:Eya2 UTSW 2 165754484 missense probably damaging 1.00
R1332:Eya2 UTSW 2 165687608 splice site probably benign
R1725:Eya2 UTSW 2 165724685 missense probably benign
R1729:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1730:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1739:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1765:Eya2 UTSW 2 165724803 missense probably damaging 0.99
R1879:Eya2 UTSW 2 165664806 missense probably benign
R1969:Eya2 UTSW 2 165716119 missense probably benign 0.00
R2430:Eya2 UTSW 2 165716130 critical splice donor site probably null
R4285:Eya2 UTSW 2 165724780 missense probably benign 0.01
R5137:Eya2 UTSW 2 165731628 missense probably damaging 1.00
R5574:Eya2 UTSW 2 165763816 missense probably damaging 1.00
R5739:Eya2 UTSW 2 165761937 missense probably damaging 1.00
R5943:Eya2 UTSW 2 165724689 missense probably damaging 0.99
R6259:Eya2 UTSW 2 165716099 missense probably benign 0.00
R6477:Eya2 UTSW 2 165763761 missense probably benign
R6736:Eya2 UTSW 2 165716037 missense possibly damaging 0.80
R7347:Eya2 UTSW 2 165687666 missense probably benign 0.00
R7524:Eya2 UTSW 2 165769326 critical splice donor site probably null
R7563:Eya2 UTSW 2 165716130 critical splice donor site probably null
R7612:Eya2 UTSW 2 165687737 critical splice donor site probably null
R8420:Eya2 UTSW 2 165767068 missense probably damaging 1.00
Z1177:Eya2 UTSW 2 165685593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACACAAGAGCTGAGAGCTATC -3'
(R):5'- CCATTCCATGTGACTGGAGCAGAG -3'

Sequencing Primer
(F):5'- GTGCAGAAAACTGTCCCTTC -3'
(R):5'- AAAGCGAGTGTTGTGTGC -3'
Posted On2013-11-08