Incidental Mutation 'R0909:Exosc9'
ID83418
Institutional Source Beutler Lab
Gene Symbol Exosc9
Ensembl Gene ENSMUSG00000027714
Gene Nameexosome component 9
SynonymsRRP45, PM/Scl-75, p6, p5, Pmscl1
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36552606-36565727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36554704 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 151 (I151F)
Ref Sequence ENSEMBL: ENSMUSP00000029269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029269] [ENSMUST00000136890] [ENSMUST00000155866]
Predicted Effect probably damaging
Transcript: ENSMUST00000029269
AA Change: I151F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029269
Gene: ENSMUSG00000027714
AA Change: I151F

DomainStartEndE-ValueType
Pfam:RNase_PH 31 163 1.7e-25 PFAM
Pfam:RNase_PH_C 189 255 3.4e-14 PFAM
low complexity region 308 324 N/A INTRINSIC
low complexity region 348 366 N/A INTRINSIC
low complexity region 396 406 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133854
Predicted Effect probably damaging
Transcript: ENSMUST00000136890
AA Change: I67F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121047
Gene: ENSMUSG00000027714
AA Change: I67F

DomainStartEndE-ValueType
Pfam:RNase_PH 1 79 3e-16 PFAM
Pfam:RNase_PH_C 105 147 3.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149041
Predicted Effect probably benign
Transcript: ENSMUST00000155866
AA Change: I151F

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122189
Gene: ENSMUSG00000027714
AA Change: I151F

DomainStartEndE-ValueType
Pfam:RNase_PH 31 163 2.6e-25 PFAM
Pfam:RNase_PH_C 189 241 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156100
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the human exosome, a exoribonuclease complex which processes and degrades RNA in the nucleus and cytoplasm. This component may play a role in mRNA degradation and the polymyositis/scleroderma autoantigen complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Exosc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Exosc9 APN 3 36553139 unclassified probably benign
IGL00949:Exosc9 APN 3 36563266 unclassified probably benign
IGL01718:Exosc9 APN 3 36553929 unclassified probably benign
IGL02072:Exosc9 APN 3 36554672 missense probably damaging 1.00
IGL02217:Exosc9 APN 3 36552744 missense probably damaging 0.99
IGL02439:Exosc9 APN 3 36553031 unclassified probably benign
IGL02871:Exosc9 APN 3 36565281 missense probably benign 0.00
IGL02994:Exosc9 APN 3 36553138 unclassified probably benign
IGL03144:Exosc9 APN 3 36554135 missense probably damaging 1.00
R1192:Exosc9 UTSW 3 36552755 unclassified probably benign
R2516:Exosc9 UTSW 3 36563162 missense probably benign
R4288:Exosc9 UTSW 3 36563216 missense probably benign
R4770:Exosc9 UTSW 3 36553835 missense probably damaging 0.98
R5875:Exosc9 UTSW 3 36561193 critical splice donor site probably null
R5928:Exosc9 UTSW 3 36555625 intron probably benign
R6120:Exosc9 UTSW 3 36554672 missense probably damaging 1.00
R7077:Exosc9 UTSW 3 36553056 missense probably damaging 1.00
R7340:Exosc9 UTSW 3 36561148 missense possibly damaging 0.86
R7443:Exosc9 UTSW 3 36553841 missense probably damaging 1.00
R7917:Exosc9 UTSW 3 36553819 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGGATAAACTGGAAGGATTAGCCG -3'
(R):5'- GCCACAGTTCTATTACAGGAGACCAAG -3'

Sequencing Primer
(F):5'- GGTCATGCTCAGTTGGGATT -3'
(R):5'- GAAACTTCTAGGGCATTTCTGACC -3'
Posted On2013-11-08