Incidental Mutation 'R0909:Chmp5'
ID83422
Institutional Source Beutler Lab
Gene Symbol Chmp5
Ensembl Gene ENSMUSG00000028419
Gene Namecharged multivesicular body protein 5
Synonyms2210412K09Rik, chromatin modifying protein 5
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0909 (G1)
Quality Score191
Status Not validated
Chromosome4
Chromosomal Location40948407-40965303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40960968 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 202 (N202K)
Ref Sequence ENSEMBL: ENSMUSP00000030128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030128]
Predicted Effect probably benign
Transcript: ENSMUST00000030128
AA Change: N202K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030128
Gene: ENSMUSG00000028419
AA Change: N202K

DomainStartEndE-ValueType
Pfam:Snf7 12 197 5.4e-58 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHMP5 belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, cardia bifida, impaired chorioallantoic fusion, abnormal somite and neural plate devlopment, accumulation of multivesicular bodies, and impaired endocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Chmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03077:Chmp5 APN 4 40952438 missense probably benign 0.34
R0480:Chmp5 UTSW 4 40948690 unclassified probably benign
R0831:Chmp5 UTSW 4 40949500 missense probably damaging 1.00
R5052:Chmp5 UTSW 4 40948608 start codon destroyed probably null 0.54
R5795:Chmp5 UTSW 4 40950562 critical splice donor site probably null
R7121:Chmp5 UTSW 4 40952217 splice site probably null
R7749:Chmp5 UTSW 4 40949488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGACAAGTGAGCCTTTTCCCTTTG -3'
(R):5'- AGCTTGCCCAGCAGTAATAGGAAAAC -3'

Sequencing Primer
(F):5'- TTCTCTACAAGTGGTCTGGC -3'
(R):5'- CGAAATAGTCTTTAGCCTCAGTGG -3'
Posted On2013-11-08