Incidental Mutation 'R0909:Rbsn'
ID83424
Institutional Source Beutler Lab
Gene Symbol Rbsn
Ensembl Gene ENSMUSG00000014550
Gene Namerabenosyn, RAB effector
Synonyms5330426D11Rik, Rabenosyn-5, Zfyve20
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92186712-92214925 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 92189810 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 618 (Q618*)
Ref Sequence ENSEMBL: ENSMUSP00000014694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014694]
Predicted Effect probably null
Transcript: ENSMUST00000014694
AA Change: Q618*
SMART Domains Protein: ENSMUSP00000014694
Gene: ENSMUSG00000014550
AA Change: Q618*

DomainStartEndE-ValueType
ZnF_C2H2 14 37 4.45e0 SMART
low complexity region 53 64 N/A INTRINSIC
FYVE 148 260 2e-10 SMART
coiled coil region 377 412 N/A INTRINSIC
Pfam:Rbsn 457 498 9e-21 PFAM
low complexity region 512 535 N/A INTRINSIC
Pfam:NPF 547 736 2.3e-61 PFAM
Pfam:Rbsn 737 778 6.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204858
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FYVE zinc finger family of proteins. The encoded protein interacts with Ras-related proteins that regulate membrane trafficking. A missense mutation in this gene is associated with a defect in the early endocytic pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Rbsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Rbsn APN 6 92207119 missense possibly damaging 0.82
IGL02073:Rbsn APN 6 92189359 missense probably damaging 1.00
IGL02962:Rbsn APN 6 92190326 missense probably benign 0.00
R0172:Rbsn UTSW 6 92211607 missense probably damaging 0.99
R0735:Rbsn UTSW 6 92189693 missense probably benign 0.01
R1146:Rbsn UTSW 6 92201730 critical splice donor site probably null
R1146:Rbsn UTSW 6 92201730 critical splice donor site probably null
R1728:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R1729:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R1784:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R2135:Rbsn UTSW 6 92189873 missense probably benign
R2183:Rbsn UTSW 6 92189637 missense probably benign 0.02
R2324:Rbsn UTSW 6 92193966 missense probably damaging 1.00
R2890:Rbsn UTSW 6 92207123 missense possibly damaging 0.52
R3729:Rbsn UTSW 6 92191335 missense possibly damaging 0.81
R4007:Rbsn UTSW 6 92189819 missense probably benign 0.00
R4356:Rbsn UTSW 6 92207048 missense possibly damaging 0.47
R5027:Rbsn UTSW 6 92198250 missense probably damaging 1.00
R5364:Rbsn UTSW 6 92193977 missense probably damaging 0.96
R5787:Rbsn UTSW 6 92199816 missense possibly damaging 0.81
R7092:Rbsn UTSW 6 92189626 missense probably damaging 1.00
R7134:Rbsn UTSW 6 92201627 missense probably damaging 1.00
R7165:Rbsn UTSW 6 92191334 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCAAAAGGGTTGGGTGCTGGAC -3'
(R):5'- CAGACTGAGAAGGCCATTGAGCTG -3'

Sequencing Primer
(F):5'- GGGATTTCCTGCCCCCAAC -3'
(R):5'- AGCAGTTCCTGGCAGCATC -3'
Posted On2013-11-08