Incidental Mutation 'R0909:Ap3s2'
ID83425
Institutional Source Beutler Lab
Gene Symbol Ap3s2
Ensembl Gene ENSMUSG00000063801
Gene Nameadaptor-related protein complex 3, sigma 2 subunit
Synonymssigma 3B, [s]3B
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79875325-79920649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79880518 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 183 (N183S)
Ref Sequence ENSEMBL: ENSMUSP00000075082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075657] [ENSMUST00000206725]
Predicted Effect probably benign
Transcript: ENSMUST00000075657
AA Change: N183S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000075082
Gene: ENSMUSG00000063801
AA Change: N183S

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 9.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206725
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Ap3s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ap3s2 APN 7 79916076 missense probably benign 0.35
R0138:Ap3s2 UTSW 7 79909869 missense probably benign 0.28
R1711:Ap3s2 UTSW 7 79880490 missense probably damaging 0.98
R4909:Ap3s2 UTSW 7 79915241 missense possibly damaging 0.90
R5041:Ap3s2 UTSW 7 79920519 missense probably benign 0.07
R5528:Ap3s2 UTSW 7 79880486 makesense probably null
R5630:Ap3s2 UTSW 7 79909899 missense probably damaging 1.00
R6725:Ap3s2 UTSW 7 79920642 unclassified probably benign
R7473:Ap3s2 UTSW 7 79916031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATGTGTTCAGTCCCAGTGGTG -3'
(R):5'- AAGGCTGCAAGGCTGCACATAG -3'

Sequencing Primer
(F):5'- ATGTCTATCACAGCCGTGAG -3'
(R):5'- CACCCATGAGGAATGAAGACTTTTG -3'
Posted On2013-11-08