Mutagenetix > Incidental Mutations

Incidental Mutation 'R0909:Ube4a'

83430

Institutional Source

Beutler Lab

Gene Symbol

Ube4a

Ensembl Gene

ENSMUSG00000059890

Gene Name

ubiquitination factor E4A

Synonyms

9930123J21Rik, UFD2b, 4732444G18Rik

MMRRC Submission

039067-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0909 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

44923127-44965600 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44939973 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 748 (I748V)

Ref Sequence

ENSEMBL: ENSMUSP00000112632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000145657] [ENSMUST00000154287]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117506
AA Change: I729V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890
AA Change: I729V

Domain	Start	End	E-Value	Type
low complexity region	288	299	N/A	INTRINSIC
Pfam:Ufd2P_core	330	766	2.6e-101	PFAM
Pfam:Ufd2P_core	762	935	7.4e-61	PFAM
Ubox	953	1016	1.9e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117549
AA Change: I748V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890
AA Change: I748V

Domain	Start	End	E-Value	Type
low complexity region	307	318	N/A	INTRINSIC
Pfam:Ufd2P_core	349	991	3.4e-155	PFAM
Ubox	1010	1073	1.9e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145657

Predicted Effect

probably benign
Transcript: ENSMUST00000154287

SMART Domains

Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890

Domain	Start	End	E-Value	Type
low complexity region	307	318	N/A	INTRINSIC
Pfam:Ufd2P_core	349	547	4.1e-39	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.4%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	T	A	19: 3,715,788	M21K	probably benign	Het
Ap3s2	T	C	7: 79,880,518	N183S	probably benign	Het
Cd109	A	G	9: 78,636,473	I100V	probably benign	Het
Cep170b	A	G	12: 112,732,039	K77R	probably null	Het
Chmp5	C	A	4: 40,960,968	N202K	probably benign	Het
Cnbd1	A	T	4: 19,122,444	L15I	probably benign	Het
Ehmt2	T	C	17: 34,906,504	V542A	possibly damaging	Het
Exosc9	A	T	3: 36,554,704	I151F	probably damaging	Het
Eya2	A	G	2: 165,754,493	N308S	probably benign	Het
Fbxw21	C	A	9: 109,156,408	A101S	possibly damaging	Het
Frem3	A	C	8: 80,663,406	N1762T	probably benign	Het
H2-DMb2	C	A	17: 34,148,809	T68N	probably benign	Het
Hbs1l	A	G	10: 21,307,738	E126G	probably benign	Het
Lrrc2	T	A	9: 110,962,673		probably null	Het
Mrpl44	G	A	1: 79,779,653	V272I	probably benign	Het
Msh4	G	A	3: 153,863,504	L723F	probably benign	Het
Nemf	T	A	12: 69,341,610	D329V	probably damaging	Het
Noxa1	A	T	2: 25,091,794	L99Q	probably damaging	Het
Nr6a1	A	T	2: 38,885,206	D44E	probably benign	Het
Obscn	T	C	11: 59,075,064	D3131G	probably damaging	Het
Olfr551	A	T	7: 102,588,447	C99S	probably damaging	Het
Olfr713	T	C	7: 107,036,194	I13T	probably benign	Het
Olfr95	T	G	17: 37,210,918	I312L	probably benign	Het
Pkhd1l1	T	A	15: 44,538,883		probably null	Het
Rbsn	G	A	6: 92,189,810	Q618*	probably null	Het
Rccd1	A	C	7: 80,319,051		probably null	Het
Scg2	T	A	1: 79,435,782	Q368L	possibly damaging	Het
Socs5	T	A	17: 87,133,773	L47Q	probably benign	Het
Ttc16	T	C	2: 32,762,868	T593A	probably benign	Het
Vipas39	T	C	12: 87,241,331	D435G	probably benign	Het
Vmn2r69	C	T	7: 85,406,665	G755D	probably benign	Het
Vsnl1	A	G	12: 11,326,371	F171S	probably damaging	Het
Wbp2nl	G	A	15: 82,314,074	A271T	probably benign	Het

Other mutations in Ube4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ube4a	APN	9	44948141	missense	probably damaging	1.00
IGL00857:Ube4a	APN	9	44932386	missense	probably damaging	1.00
IGL01067:Ube4a	APN	9	44944865	missense	probably damaging	0.96
White_way	UTSW	9	44949753	nonsense	probably null
R0243:Ube4a	UTSW	9	44946178	unclassified	probably benign
R0355:Ube4a	UTSW	9	44944801	splice site	probably benign
R0680:Ube4a	UTSW	9	44948060	missense	probably damaging	1.00
R0863:Ube4a	UTSW	9	44949816	missense	possibly damaging	0.55
R1597:Ube4a	UTSW	9	44929766	missense	possibly damaging	0.93
R1611:Ube4a	UTSW	9	44956737	intron	probably benign
R1871:Ube4a	UTSW	9	44944937	splice site	probably null
R2069:Ube4a	UTSW	9	44948099	missense	probably damaging	0.96
R2518:Ube4a	UTSW	9	44948137	missense	probably benign	0.29
R3079:Ube4a	UTSW	9	44960073	missense	probably damaging	1.00
R3404:Ube4a	UTSW	9	44929687	missense	probably damaging	1.00
R3726:Ube4a	UTSW	9	44933323	missense	probably damaging	0.97
R3758:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4027:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4029:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4111:Ube4a	UTSW	9	44948949	missense	probably damaging	0.97
R4113:Ube4a	UTSW	9	44948949	missense	probably damaging	0.97
R4238:Ube4a	UTSW	9	44939999	missense	probably damaging	1.00
R4365:Ube4a	UTSW	9	44960081	missense	probably damaging	1.00
R4471:Ube4a	UTSW	9	44946532	unclassified	probably benign
R4793:Ube4a	UTSW	9	44948822	missense	probably damaging	1.00
R5069:Ube4a	UTSW	9	44940089	missense	probably damaging	1.00
R5214:Ube4a	UTSW	9	44948868	missense	probably benign	0.22
R5225:Ube4a	UTSW	9	44939960	critical splice donor site	probably null
R5416:Ube4a	UTSW	9	44941178	missense	probably damaging	0.99
R5641:Ube4a	UTSW	9	44950881	missense	probably damaging	0.99
R5729:Ube4a	UTSW	9	44933329	missense	probably damaging	1.00
R5774:Ube4a	UTSW	9	44953097	missense	probably damaging	0.99
R5908:Ube4a	UTSW	9	44948024	critical splice donor site	probably null
R6191:Ube4a	UTSW	9	44949753	nonsense	probably null
R6752:Ube4a	UTSW	9	44925948	missense	probably damaging	1.00
R6886:Ube4a	UTSW	9	44948843	missense	probably damaging	0.96
R6911:Ube4a	UTSW	9	44942758	missense	probably damaging	1.00
R7417:Ube4a	UTSW	9	44956713	missense	probably benign	0.08
R7650:Ube4a	UTSW	9	44933436	missense	probably damaging	0.99
R7747:Ube4a	UTSW	9	44925973	missense	probably damaging	1.00
R7798:Ube4a	UTSW	9	44933331	missense	probably damaging	1.00
R7842:Ube4a	UTSW	9	44949727	splice site	probably null
R7853:Ube4a	UTSW	9	44953010	missense	probably benign	0.43
R8109:Ube4a	UTSW	9	44935483	missense	probably benign	0.00
R8223:Ube4a	UTSW	9	44960035	missense	possibly damaging	0.94
R8401:Ube4a	UTSW	9	44941229	missense	possibly damaging	0.84
R8523:Ube4a	UTSW	9	44949832	missense	probably damaging	1.00
X0025:Ube4a	UTSW	9	44942818	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- ACAGAAGAGGGAGACAATGCTGTCTAC -3'
(R):5'- AACTAGCAGAGGTGTTAGAAGCAGTGAT -3'

Sequencing Primer
(F):5'- caccgtcttgtctctgcc -3'
(R):5'- TTAGAAGCAGTGATGCCTCACC -3'

Posted On

2013-11-08