Incidental Mutation 'R0909:Lrrc2'
ID83433
Institutional Source Beutler Lab
Gene Symbol Lrrc2
Ensembl Gene ENSMUSG00000032495
Gene Nameleucine rich repeat containing 2
Synonyms
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110951545-110984066 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 110962673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035076] [ENSMUST00000196834]
Predicted Effect probably null
Transcript: ENSMUST00000035076
SMART Domains Protein: ENSMUSP00000035076
Gene: ENSMUSG00000032495

DomainStartEndE-ValueType
Blast:LRR 143 165 5e-7 BLAST
LRR_TYP 166 189 4.87e-4 SMART
LRR 236 258 1.41e1 SMART
LRR 259 282 2.27e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196598
Predicted Effect probably null
Transcript: ENSMUST00000196834
SMART Domains Protein: ENSMUSP00000142360
Gene: ENSMUSG00000032495

DomainStartEndE-ValueType
Blast:LRR 77 99 2e-7 BLAST
LRR_TYP 100 123 2e-6 SMART
LRR 147 170 6.2e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing family of proteins, which function in diverse biological pathways. This family member may possibly be a nuclear protein. Similarity to the RAS suppressor protein, as well as expression down-regulation observed in tumor cells, suggests that it may function as a tumor suppressor. The gene is located in the chromosome 3 common eliminated region 1 (C3CER1), a 1.4 Mb region that is commonly deleted in diverse tumors. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Lrrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Lrrc2 APN 9 110980818 splice site probably null
IGL02243:Lrrc2 APN 9 110970057 missense probably damaging 1.00
IGL02715:Lrrc2 APN 9 110970114 missense probably damaging 1.00
IGL02793:Lrrc2 APN 9 110979627 critical splice donor site probably null
IGL02958:Lrrc2 APN 9 110962673 critical splice donor site probably null
PIT4362001:Lrrc2 UTSW 9 110962540 missense possibly damaging 0.91
R0255:Lrrc2 UTSW 9 110980898 missense possibly damaging 0.87
R0472:Lrrc2 UTSW 9 110962617 missense probably benign 0.00
R1575:Lrrc2 UTSW 9 110979487 missense probably benign 0.07
R1619:Lrrc2 UTSW 9 110960973 missense probably benign 0.00
R1669:Lrrc2 UTSW 9 110981650 missense probably damaging 0.99
R1778:Lrrc2 UTSW 9 110980840 missense probably benign
R1914:Lrrc2 UTSW 9 110980939 missense probably damaging 1.00
R2165:Lrrc2 UTSW 9 110979577 missense possibly damaging 0.78
R3792:Lrrc2 UTSW 9 110966517 nonsense probably null
R3793:Lrrc2 UTSW 9 110966517 nonsense probably null
R4499:Lrrc2 UTSW 9 110962645 missense probably benign 0.11
R4683:Lrrc2 UTSW 9 110962546 missense possibly damaging 0.95
R4693:Lrrc2 UTSW 9 110970093 missense probably damaging 1.00
R4723:Lrrc2 UTSW 9 110970160 critical splice donor site probably null
R5033:Lrrc2 UTSW 9 110980919 missense probably damaging 0.98
R5935:Lrrc2 UTSW 9 110966561 missense probably benign 0.17
R6269:Lrrc2 UTSW 9 110980949 missense probably damaging 1.00
R6645:Lrrc2 UTSW 9 110970107 missense probably damaging 1.00
R6855:Lrrc2 UTSW 9 110953182 splice site probably null
R7621:Lrrc2 UTSW 9 110980831 missense probably benign 0.00
R7748:Lrrc2 UTSW 9 110980931 missense possibly damaging 0.63
R7827:Lrrc2 UTSW 9 110960981 missense possibly damaging 0.93
R8169:Lrrc2 UTSW 9 110980886 missense probably benign
R8186:Lrrc2 UTSW 9 110960842 missense possibly damaging 0.67
R8458:Lrrc2 UTSW 9 110970150 missense probably damaging 1.00
RF009:Lrrc2 UTSW 9 110981676 makesense probably null
RF021:Lrrc2 UTSW 9 110981676 makesense probably null
Predicted Primers PCR Primer
(F):5'- CGCAGTTTGGCTCTGATGTTCTCAC -3'
(R):5'- GCCCACTCCTAAGACTTCAGGTTTC -3'

Sequencing Primer
(F):5'- AAATCCTTGGCTTGGAGCAC -3'
(R):5'- GACTTCAGGTTTCTAAGCAACTGC -3'
Posted On2013-11-08