Incidental Mutation 'R0909:Nemf'
ID83437
Institutional Source Beutler Lab
Gene Symbol Nemf
Ensembl Gene ENSMUSG00000020982
Gene Namenuclear export mediator factor
Synonyms1500011I12Rik, 4933405E14Rik, Sdccag1
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69310522-69357165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69341610 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 329 (D329V)
Ref Sequence ENSEMBL: ENSMUSP00000021368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021368] [ENSMUST00000021368]
Predicted Effect probably damaging
Transcript: ENSMUST00000021368
AA Change: D329V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982
AA Change: D329V

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021368
AA Change: D329V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982
AA Change: D329V

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222763
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the ribosome quality control complex. The encoded protein facilitates the recognition and ubiquitination of stalled 60S subunits by the ubiquitin ligase listerin. A similar protein in fly functions as a tumor suppressor. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Nemf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Nemf APN 12 69344986 splice site probably benign
IGL02499:Nemf APN 12 69322129 missense probably damaging 1.00
IGL03352:Nemf APN 12 69331905 missense probably damaging 1.00
kaempfer UTSW 12 69352336 missense probably benign 0.01
R0335:Nemf UTSW 12 69353803 missense probably benign 0.16
R0538:Nemf UTSW 12 69356314 missense probably damaging 1.00
R0581:Nemf UTSW 12 69322271 missense probably benign
R1792:Nemf UTSW 12 69312569 missense probably damaging 1.00
R1899:Nemf UTSW 12 69346378 missense probably null
R2080:Nemf UTSW 12 69353786 splice site probably benign
R3704:Nemf UTSW 12 69331130 missense probably damaging 1.00
R3842:Nemf UTSW 12 69331949 missense probably damaging 0.98
R4471:Nemf UTSW 12 69314442 missense probably benign 0.04
R4666:Nemf UTSW 12 69312280 missense probably damaging 1.00
R4720:Nemf UTSW 12 69324288 missense probably benign 0.05
R5198:Nemf UTSW 12 69356047 missense probably damaging 1.00
R5474:Nemf UTSW 12 69316335 missense probably benign 0.03
R6893:Nemf UTSW 12 69352336 missense probably benign 0.01
R7008:Nemf UTSW 12 69341621 missense possibly damaging 0.91
R7008:Nemf UTSW 12 69353793 critical splice donor site probably null
R7098:Nemf UTSW 12 69312467 missense probably damaging 1.00
R7154:Nemf UTSW 12 69316741 critical splice donor site probably null
R7452:Nemf UTSW 12 69337959 splice site probably null
R8130:Nemf UTSW 12 69356052 missense possibly damaging 0.91
R8340:Nemf UTSW 12 69353885 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAACGCACTTCGGACTACCTGAAT -3'
(R):5'- GGGAGCGAACTTTGGGGAAACTTT -3'

Sequencing Primer
(F):5'- GGACTACCTGAATGGCTCTGTC -3'
(R):5'- TGGGGAAACTTTTTAAGTTGCC -3'
Posted On2013-11-08