Incidental Mutation 'R0909:Vipas39'
ID83438
Institutional Source Beutler Lab
Gene Symbol Vipas39
Ensembl Gene ENSMUSG00000021038
Gene NameVPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Synonyms
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R0909 (G1)
Quality Score210
Status Not validated
Chromosome12
Chromosomal Location87238868-87266256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87241331 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 435 (D435G)
Ref Sequence ENSEMBL: ENSMUSP00000137190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021426] [ENSMUST00000072744] [ENSMUST00000179379] [ENSMUST00000221768] [ENSMUST00000222480]
Predicted Effect probably benign
Transcript: ENSMUST00000021426
AA Change: D435G

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021426
Gene: ENSMUSG00000021038
AA Change: D435G

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072744
AA Change: D454G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000072527
Gene: ENSMUSG00000021038
AA Change: D454G

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 489 3.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179379
AA Change: D435G

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137190
Gene: ENSMUSG00000021038
AA Change: D435G

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221707
Predicted Effect probably benign
Transcript: ENSMUST00000221768
Predicted Effect probably benign
Transcript: ENSMUST00000222480
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry and scaly skin, hair loss, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Vipas39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Vipas39 APN 12 87249397 missense probably benign 0.03
IGL01418:Vipas39 APN 12 87249397 missense probably benign 0.03
IGL02026:Vipas39 APN 12 87251709 splice site probably benign
IGL03089:Vipas39 APN 12 87253254 missense probably damaging 1.00
R0173:Vipas39 UTSW 12 87250511 splice site probably benign
R1505:Vipas39 UTSW 12 87246160 missense probably damaging 1.00
R2897:Vipas39 UTSW 12 87242523 missense possibly damaging 0.78
R2968:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R2969:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R2970:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R4622:Vipas39 UTSW 12 87244543 missense probably damaging 1.00
R4676:Vipas39 UTSW 12 87241301 missense probably damaging 1.00
R5181:Vipas39 UTSW 12 87239827 missense probably damaging 1.00
R5188:Vipas39 UTSW 12 87254247 missense probably benign 0.21
R5881:Vipas39 UTSW 12 87251807 nonsense probably null
R6080:Vipas39 UTSW 12 87241953 missense probably damaging 1.00
R6425:Vipas39 UTSW 12 87241289 missense probably damaging 0.98
R6896:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R7438:Vipas39 UTSW 12 87241931 splice site probably null
R7538:Vipas39 UTSW 12 87263903 critical splice donor site probably null
R8436:Vipas39 UTSW 12 87257417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCATCTGCCTAGATCTTGGAGC -3'
(R):5'- CCGGTCTCCGAATTGAATTCTCAGC -3'

Sequencing Primer
(F):5'- ATCTTGGAGCATACACTGGC -3'
(R):5'- gttcaaatcccagcaaccac -3'
Posted On2013-11-08