Incidental Mutation 'R0909:H2-DMb2'
ID83444
Institutional Source Beutler Lab
Gene Symbol H2-DMb2
Ensembl Gene ENSMUSG00000037548
Gene Namehistocompatibility 2, class II, locus Mb2
SynonymsH2-M beta2, H-2Mb2, H2-Mb2
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0909 (G1)
Quality Score213
Status Not validated
Chromosome17
Chromosomal Location34143307-34151553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34148809 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 68 (T68N)
Ref Sequence ENSEMBL: ENSMUSP00000126533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041982] [ENSMUST00000114232] [ENSMUST00000171231]
Predicted Effect probably benign
Transcript: ENSMUST00000041982
AA Change: T199N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043526
Gene: ENSMUSG00000037548
AA Change: T199N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
MHC_II_beta 27 105 7.87e-27 SMART
IGc1 130 202 9.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114232
SMART Domains Protein: ENSMUSP00000109870
Gene: ENSMUSG00000079547

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
MHC_II_beta 27 105 3.45e-23 SMART
IGc1 130 202 9.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171231
AA Change: T68N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126533
Gene: ENSMUSG00000037548
AA Change: T68N

DomainStartEndE-ValueType
IGc1 2 71 6.48e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173262
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in H2-DMb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:H2-DMb2 APN 17 34148613 missense probably damaging 1.00
IGL01077:H2-DMb2 APN 17 34147720 missense probably damaging 1.00
IGL02691:H2-DMb2 APN 17 34147858 missense probably benign
R1299:H2-DMb2 UTSW 17 34150587 missense probably benign 0.08
R1882:H2-DMb2 UTSW 17 34147860 missense probably damaging 1.00
R4770:H2-DMb2 UTSW 17 34148724 missense probably damaging 1.00
R4914:H2-DMb2 UTSW 17 34150529 missense probably benign 0.05
R5265:H2-DMb2 UTSW 17 34148562 missense probably damaging 1.00
R5561:H2-DMb2 UTSW 17 34145471 critical splice donor site probably null
R5906:H2-DMb2 UTSW 17 34148608 start codon destroyed probably null 0.99
R7970:H2-DMb2 UTSW 17 34150598 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTAACACAAGGGAGCCCGTGATGC -3'
(R):5'- CCTTTAGTCGGGAACCAACACTGC -3'

Sequencing Primer
(F):5'- GTGATGCTGGCCTGCTAC -3'
(R):5'- TGCTAACCCTTAACAGGCTC -3'
Posted On2013-11-08