Incidental Mutation 'R0909:Olfr95'
ID83446
Institutional Source Beutler Lab
Gene Symbol Olfr95
Ensembl Gene ENSMUSG00000049561
Gene Nameolfactory receptor 95
SynonymsMOR263-6, GA_x6K02T2PSCP-1651760-1650822
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0909 (G1)
Quality Score215
Status Not validated
Chromosome17
Chromosomal Location37207950-37213118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37210918 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 312 (I312L)
Ref Sequence ENSEMBL: ENSMUSP00000150480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060728] [ENSMUST00000216318]
Predicted Effect probably benign
Transcript: ENSMUST00000060728
AA Change: I312L

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058929
Gene: ENSMUSG00000049561
AA Change: I312L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.9e-57 PFAM
Pfam:7TM_GPCR_Srsx 34 259 1.7e-6 PFAM
Pfam:7tm_1 40 289 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216318
AA Change: I312L

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Olfr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Olfr95 APN 17 37210986 missense probably damaging 1.00
IGL03306:Olfr95 APN 17 37211677 missense probably damaging 1.00
PIT4377001:Olfr95 UTSW 17 37211089 missense probably benign 0.00
R0668:Olfr95 UTSW 17 37211644 missense probably damaging 1.00
R1442:Olfr95 UTSW 17 37211704 missense probably benign 0.00
R1557:Olfr95 UTSW 17 37211353 missense probably damaging 1.00
R1758:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R3195:Olfr95 UTSW 17 37211536 missense possibly damaging 0.87
R3749:Olfr95 UTSW 17 37211800 missense possibly damaging 0.55
R3778:Olfr95 UTSW 17 37211758 missense probably benign
R4458:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R4591:Olfr95 UTSW 17 37211119 missense probably benign
R5058:Olfr95 UTSW 17 37211667 missense probably damaging 1.00
R5060:Olfr95 UTSW 17 37211416 missense probably benign 0.00
R5903:Olfr95 UTSW 17 37211021 nonsense probably null
R6294:Olfr95 UTSW 17 37211626 missense probably benign 0.19
R6689:Olfr95 UTSW 17 37211157 missense probably damaging 1.00
R7196:Olfr95 UTSW 17 37211193 missense probably damaging 1.00
R7677:Olfr95 UTSW 17 37211495 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAGATAACGTTCAGGACTATTGCTC -3'
(R):5'- TATATCCGCCCTAAGGCCAGCTATGAC -3'

Sequencing Primer
(F):5'- catgcactgccaccacc -3'
(R):5'- TAAGGCCAGCTATGACCCAAC -3'
Posted On2013-11-08