Incidental Mutation 'R0909:Socs5'
ID83447
Institutional Source Beutler Lab
Gene Symbol Socs5
Ensembl Gene ENSMUSG00000037104
Gene Namesuppressor of cytokine signaling 5
SynonymsCish5, 1810018L08Rik, SOCS-5
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location87107679-87137583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87133773 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 47 (L47Q)
Ref Sequence ENSEMBL: ENSMUSP00000038591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041369]
Predicted Effect probably benign
Transcript: ENSMUST00000041369
AA Change: L47Q

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038591
Gene: ENSMUSG00000037104
AA Change: L47Q

DomainStartEndE-ValueType
Pfam:SOCS 145 197 8.4e-20 PFAM
low complexity region 258 270 N/A INTRINSIC
SH2 379 465 4.59e-18 SMART
SOCS 475 518 1.65e-19 SMART
SOCS_box 481 517 3.74e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS) family, also known as STAT-induced STAT inhibitor (SSI) protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The specific function of this protein has not yet been determined. Two alternatively spliced transcript variants encoding an identical protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are viable and fertile with normal immune system morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Socs5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02426:Socs5 APN 17 87134892 missense probably damaging 1.00
IGL02553:Socs5 APN 17 87134991 missense probably damaging 1.00
PIT1430001:Socs5 UTSW 17 87133616 splice site probably benign
R1595:Socs5 UTSW 17 87134195 missense probably damaging 1.00
R2397:Socs5 UTSW 17 87134949 missense probably damaging 1.00
R3160:Socs5 UTSW 17 87134718 missense probably damaging 1.00
R3162:Socs5 UTSW 17 87134718 missense probably damaging 1.00
R5264:Socs5 UTSW 17 87134341 missense probably damaging 1.00
R5483:Socs5 UTSW 17 87134974 missense probably damaging 1.00
R6604:Socs5 UTSW 17 87135125 missense probably damaging 1.00
R7790:Socs5 UTSW 17 87134363 missense probably benign 0.03
R8205:Socs5 UTSW 17 87133710 missense probably benign 0.01
X0011:Socs5 UTSW 17 87134940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTGGAAGTATGTGGGTAAGCC -3'
(R):5'- CGAGTCACTGTCTTTCTCGATGCTG -3'

Sequencing Primer
(F):5'- GCTCACAGCAAAGTTAGTGTC -3'
(R):5'- CTGATTTCAACCACTTGAGGG -3'
Posted On2013-11-08