Incidental Mutation 'R0890:Olfr3'
ID83451
Institutional Source Beutler Lab
Gene Symbol Olfr3
Ensembl Gene ENSMUSG00000075384
Gene Nameolfactory receptor 3
SynonymsMOR136-14, Y71, GA_x6K02T2NLDC-33507606-33506665
MMRRC Submission 039053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0890 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36811492-36817032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36812574 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 173 (T173S)
Ref Sequence ENSEMBL: ENSMUSP00000149118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100151] [ENSMUST00000213988]
Predicted Effect probably benign
Transcript: ENSMUST00000100151
AA Change: T173S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097728
Gene: ENSMUSG00000075384
AA Change: T173S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 220 2.9e-7 PFAM
Pfam:7tm_1 41 290 6.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120418
Predicted Effect probably benign
Transcript: ENSMUST00000213988
AA Change: T173S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,373,713 S837P probably benign Het
Cdh24 A G 14: 54,632,594 V240A probably benign Het
Clcn4 T C 7: 7,288,965 T556A possibly damaging Het
Coa7 G A 4: 108,338,386 A171T probably damaging Het
Col12a1 A T 9: 79,700,402 S381R probably damaging Het
Col9a3 C T 2: 180,610,063 P335L probably benign Het
Dcxr T A 11: 120,726,471 N82I probably damaging Het
Dhdh T C 7: 45,481,971 D146G possibly damaging Het
Dhrs13 T A 11: 78,034,350 L99Q probably null Het
Dnaic1 C T 4: 41,604,253 T220M possibly damaging Het
Gapvd1 T A 2: 34,712,317 D606V probably damaging Het
Gcn1l1 T G 5: 115,579,793 C246G possibly damaging Het
Gdf10 A G 14: 33,932,156 K207E possibly damaging Het
Gucy2d T C 7: 98,473,265 V1046A probably benign Het
Itpr3 C A 17: 27,089,011 Y257* probably null Het
Kifc5b C T 17: 26,923,022 T158M possibly damaging Het
Klra7 C T 6: 130,218,953 D251N probably benign Het
Mesp1 T C 7: 79,792,935 D198G probably benign Het
Mrgprb8 T A 7: 48,389,029 C149* probably null Het
Nphp4 C A 4: 152,498,220 L169I possibly damaging Het
Olfr183 T A 16: 58,999,787 I34K possibly damaging Het
Olfr551 C A 7: 102,588,201 E181* probably null Het
Pcgf5 A T 19: 36,412,144 H7L probably benign Het
Polr3b A C 10: 84,714,336 K970T probably benign Het
Pomgnt1 A G 4: 116,152,185 D93G probably benign Het
Rnf213 A G 11: 119,430,486 K1256E possibly damaging Het
Scn9a T C 2: 66,483,735 T1869A probably damaging Het
Setdb2 A G 14: 59,419,220 V232A possibly damaging Het
Sh3d21 T C 4: 126,151,152 E578G probably damaging Het
Tmem168 A T 6: 13,603,272 S32T probably damaging Het
Vmn1r38 T G 6: 66,776,530 I201L probably benign Het
Wfs1 C A 5: 36,975,544 W130C probably damaging Het
Other mutations in Olfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Olfr3 APN 2 36812403 missense probably benign
R0501:Olfr3 UTSW 2 36812480 nonsense probably null
R0519:Olfr3 UTSW 2 36812615 missense probably damaging 1.00
R1353:Olfr3 UTSW 2 36812914 missense possibly damaging 0.59
R1543:Olfr3 UTSW 2 36813057 missense probably damaging 1.00
R3435:Olfr3 UTSW 2 36812678 missense probably benign 0.06
R4378:Olfr3 UTSW 2 36812469 missense probably benign
R4585:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4586:Olfr3 UTSW 2 36812525 missense probably damaging 1.00
R4626:Olfr3 UTSW 2 36812259 missense probably damaging 0.98
R4714:Olfr3 UTSW 2 36813035 missense probably benign 0.37
R4720:Olfr3 UTSW 2 36812472 missense probably benign 0.03
R5390:Olfr3 UTSW 2 36812432 missense probably benign
R5659:Olfr3 UTSW 2 36812954 missense probably damaging 1.00
R5681:Olfr3 UTSW 2 36812681 missense probably benign 0.18
R6750:Olfr3 UTSW 2 36812942 missense possibly damaging 0.90
R7003:Olfr3 UTSW 2 36813035 missense possibly damaging 0.51
R7353:Olfr3 UTSW 2 36812903 missense probably damaging 1.00
R7514:Olfr3 UTSW 2 36812639 missense probably benign 0.03
R8094:Olfr3 UTSW 2 36812318 missense probably damaging 1.00
R8298:Olfr3 UTSW 2 36813026 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTGAACCCAATACGGCCATAAGAG -3'
(R):5'- TCAGCCATTTGGCCTTCACAGAC -3'

Sequencing Primer
(F):5'- CCCAATACGGCCATAAGAGATGAG -3'
(R):5'- ACCCATTACCTATGAGGAGTGTG -3'
Posted On2013-11-08