Incidental Mutation 'R0890:Vmn1r38'
ID83464
Institutional Source Beutler Lab
Gene Symbol Vmn1r38
Ensembl Gene ENSMUSG00000115170
Gene Namevomeronasal 1 receptor 38
SynonymsV1rc13
MMRRC Submission 039053-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R0890 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location66774003-66782627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 66776530 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 201 (I201L)
Ref Sequence ENSEMBL: ENSMUSP00000154495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176121] [ENSMUST00000226457] [ENSMUST00000227493] [ENSMUST00000227694]
Predicted Effect probably benign
Transcript: ENSMUST00000176121
AA Change: I201L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135117
Gene: ENSMUSG00000093632
AA Change: I201L

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226457
AA Change: I201L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227493
AA Change: I201L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227694
AA Change: I201L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,373,713 S837P probably benign Het
Cdh24 A G 14: 54,632,594 V240A probably benign Het
Clcn4 T C 7: 7,288,965 T556A possibly damaging Het
Coa7 G A 4: 108,338,386 A171T probably damaging Het
Col12a1 A T 9: 79,700,402 S381R probably damaging Het
Col9a3 C T 2: 180,610,063 P335L probably benign Het
Dcxr T A 11: 120,726,471 N82I probably damaging Het
Dhdh T C 7: 45,481,971 D146G possibly damaging Het
Dhrs13 T A 11: 78,034,350 L99Q probably null Het
Dnaic1 C T 4: 41,604,253 T220M possibly damaging Het
Gapvd1 T A 2: 34,712,317 D606V probably damaging Het
Gcn1l1 T G 5: 115,579,793 C246G possibly damaging Het
Gdf10 A G 14: 33,932,156 K207E possibly damaging Het
Gucy2d T C 7: 98,473,265 V1046A probably benign Het
Itpr3 C A 17: 27,089,011 Y257* probably null Het
Kifc5b C T 17: 26,923,022 T158M possibly damaging Het
Klra7 C T 6: 130,218,953 D251N probably benign Het
Mesp1 T C 7: 79,792,935 D198G probably benign Het
Mrgprb8 T A 7: 48,389,029 C149* probably null Het
Nphp4 C A 4: 152,498,220 L169I possibly damaging Het
Olfr183 T A 16: 58,999,787 I34K possibly damaging Het
Olfr3 T A 2: 36,812,574 T173S probably benign Het
Olfr551 C A 7: 102,588,201 E181* probably null Het
Pcgf5 A T 19: 36,412,144 H7L probably benign Het
Polr3b A C 10: 84,714,336 K970T probably benign Het
Pomgnt1 A G 4: 116,152,185 D93G probably benign Het
Rnf213 A G 11: 119,430,486 K1256E possibly damaging Het
Scn9a T C 2: 66,483,735 T1869A probably damaging Het
Setdb2 A G 14: 59,419,220 V232A possibly damaging Het
Sh3d21 T C 4: 126,151,152 E578G probably damaging Het
Tmem168 A T 6: 13,603,272 S32T probably damaging Het
Wfs1 C A 5: 36,975,544 W130C probably damaging Het
Other mutations in Vmn1r38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Vmn1r38 APN 6 66776376 missense probably benign 0.00
IGL02471:Vmn1r38 APN 6 66776767 missense probably benign 0.06
R0483:Vmn1r38 UTSW 6 66776995 missense probably benign 0.10
R1242:Vmn1r38 UTSW 6 66776360 nonsense probably null
R1557:Vmn1r38 UTSW 6 66776386 missense probably benign 0.01
R2266:Vmn1r38 UTSW 6 66776449 missense probably benign 0.02
R2320:Vmn1r38 UTSW 6 66776550 missense possibly damaging 0.94
R2568:Vmn1r38 UTSW 6 66776971 missense probably benign 0.00
R3104:Vmn1r38 UTSW 6 66776446 missense probably benign 0.31
R3552:Vmn1r38 UTSW 6 66776493 missense possibly damaging 0.95
R3792:Vmn1r38 UTSW 6 66776907 missense probably benign 0.01
R4061:Vmn1r38 UTSW 6 66776848 missense possibly damaging 0.87
R4532:Vmn1r38 UTSW 6 66777032 missense probably benign 0.38
R5299:Vmn1r38 UTSW 6 66776698 missense probably benign 0.06
R7173:Vmn1r38 UTSW 6 66776294 missense possibly damaging 0.88
X0022:Vmn1r38 UTSW 6 66777067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCTGAACAGTAAGCATGACTGGG -3'
(R):5'- TATCAGCATCACCTGCCTCCTGAG -3'

Sequencing Primer
(F):5'- AGCATGACTGGGTCATACATC -3'
(R):5'- TTCCAGGCTGTGACGATCAG -3'
Posted On2013-11-08