Incidental Mutation 'R0890:Polr3b'
ID 83475
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission 039053-MU
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0890 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 84714336 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 970 (K970T)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably benign
Transcript: ENSMUST00000077175
AA Change: K970T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: K970T

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,373,713 S837P probably benign Het
Cdh24 A G 14: 54,632,594 V240A probably benign Het
Clcn4 T C 7: 7,288,965 T556A possibly damaging Het
Coa7 G A 4: 108,338,386 A171T probably damaging Het
Col12a1 A T 9: 79,700,402 S381R probably damaging Het
Col9a3 C T 2: 180,610,063 P335L probably benign Het
Dcxr T A 11: 120,726,471 N82I probably damaging Het
Dhdh T C 7: 45,481,971 D146G possibly damaging Het
Dhrs13 T A 11: 78,034,350 L99Q probably null Het
Dnaic1 C T 4: 41,604,253 T220M possibly damaging Het
Gapvd1 T A 2: 34,712,317 D606V probably damaging Het
Gcn1l1 T G 5: 115,579,793 C246G possibly damaging Het
Gdf10 A G 14: 33,932,156 K207E possibly damaging Het
Gucy2d T C 7: 98,473,265 V1046A probably benign Het
Itpr3 C A 17: 27,089,011 Y257* probably null Het
Kifc5b C T 17: 26,923,022 T158M possibly damaging Het
Klra7 C T 6: 130,218,953 D251N probably benign Het
Mesp1 T C 7: 79,792,935 D198G probably benign Het
Mrgprb8 T A 7: 48,389,029 C149* probably null Het
Nphp4 C A 4: 152,498,220 L169I possibly damaging Het
Olfr183 T A 16: 58,999,787 I34K possibly damaging Het
Olfr3 T A 2: 36,812,574 T173S probably benign Het
Olfr551 C A 7: 102,588,201 E181* probably null Het
Pcgf5 A T 19: 36,412,144 H7L probably benign Het
Pomgnt1 A G 4: 116,152,185 D93G probably benign Het
Rnf213 A G 11: 119,430,486 K1256E possibly damaging Het
Scn9a T C 2: 66,483,735 T1869A probably damaging Het
Setdb2 A G 14: 59,419,220 V232A possibly damaging Het
Sh3d21 T C 4: 126,151,152 E578G probably damaging Het
Tmem168 A T 6: 13,603,272 S32T probably damaging Het
Vmn1r38 T G 6: 66,776,530 I201L probably benign Het
Wfs1 C A 5: 36,975,544 W130C probably damaging Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGGAACATAAGCCAAAAGGCCG -3'
(R):5'- ACACACATTAGGTGTGAACACTGGG -3'

Sequencing Primer
(F):5'- GCCGAGAGAACTGACAGCC -3'
(R):5'- CTCAGATGCAGTTAATGTACGCC -3'
Posted On 2013-11-08