Incidental Mutation 'R0890:Dhrs13'
ID83476
Institutional Source Beutler Lab
Gene Symbol Dhrs13
Ensembl Gene ENSMUSG00000020834
Gene Namedehydrogenase/reductase (SDR family) member 13
Synonyms
MMRRC Submission 039053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0890 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78032280-78037866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78034350 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 99 (L99Q)
Ref Sequence ENSEMBL: ENSMUSP00000112553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021187] [ENSMUST00000049167] [ENSMUST00000072289] [ENSMUST00000073660] [ENSMUST00000092881] [ENSMUST00000100784] [ENSMUST00000122342] [ENSMUST00000144028] [ENSMUST00000148162]
Predicted Effect probably null
Transcript: ENSMUST00000021187
AA Change: L149Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021187
Gene: ENSMUSG00000020834
AA Change: L149Q

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:KR 37 176 1.6e-10 PFAM
Pfam:adh_short 37 238 6e-32 PFAM
Pfam:Epimerase 39 256 3.4e-7 PFAM
low complexity region 317 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049167
SMART Domains Protein: ENSMUSP00000044990
Gene: ENSMUSG00000037791

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
Pfam:PHF12_MRG_bd 202 241 1.3e-21 PFAM
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Blast:FHA 813 868 9e-34 BLAST
low complexity region 905 916 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072289
SMART Domains Protein: ENSMUSP00000072136
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 6.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073660
SMART Domains Protein: ENSMUSP00000073342
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 5.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092881
SMART Domains Protein: ENSMUSP00000090557
Gene: ENSMUSG00000020834

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:adh_short 37 111 3.2e-9 PFAM
Pfam:NAD_binding_10 39 116 7.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100784
SMART Domains Protein: ENSMUSP00000098347
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 38 220 1.34e-10 SMART
Blast:PHB 277 347 2e-35 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000122342
AA Change: L99Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112553
Gene: ENSMUSG00000020834
AA Change: L99Q

DomainStartEndE-ValueType
Pfam:adh_short 1 131 9.1e-17 PFAM
low complexity region 267 292 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125079
Predicted Effect probably benign
Transcript: ENSMUST00000144028
Predicted Effect probably benign
Transcript: ENSMUST00000148162
SMART Domains Protein: ENSMUSP00000133147
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
Blast:PHB 2 74 2e-34 BLAST
PDB:1WIN|A 40 74 2e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150471
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,373,713 S837P probably benign Het
Cdh24 A G 14: 54,632,594 V240A probably benign Het
Clcn4 T C 7: 7,288,965 T556A possibly damaging Het
Coa7 G A 4: 108,338,386 A171T probably damaging Het
Col12a1 A T 9: 79,700,402 S381R probably damaging Het
Col9a3 C T 2: 180,610,063 P335L probably benign Het
Dcxr T A 11: 120,726,471 N82I probably damaging Het
Dhdh T C 7: 45,481,971 D146G possibly damaging Het
Dnaic1 C T 4: 41,604,253 T220M possibly damaging Het
Gapvd1 T A 2: 34,712,317 D606V probably damaging Het
Gcn1l1 T G 5: 115,579,793 C246G possibly damaging Het
Gdf10 A G 14: 33,932,156 K207E possibly damaging Het
Gucy2d T C 7: 98,473,265 V1046A probably benign Het
Itpr3 C A 17: 27,089,011 Y257* probably null Het
Kifc5b C T 17: 26,923,022 T158M possibly damaging Het
Klra7 C T 6: 130,218,953 D251N probably benign Het
Mesp1 T C 7: 79,792,935 D198G probably benign Het
Mrgprb8 T A 7: 48,389,029 C149* probably null Het
Nphp4 C A 4: 152,498,220 L169I possibly damaging Het
Olfr183 T A 16: 58,999,787 I34K possibly damaging Het
Olfr3 T A 2: 36,812,574 T173S probably benign Het
Olfr551 C A 7: 102,588,201 E181* probably null Het
Pcgf5 A T 19: 36,412,144 H7L probably benign Het
Polr3b A C 10: 84,714,336 K970T probably benign Het
Pomgnt1 A G 4: 116,152,185 D93G probably benign Het
Rnf213 A G 11: 119,430,486 K1256E possibly damaging Het
Scn9a T C 2: 66,483,735 T1869A probably damaging Het
Setdb2 A G 14: 59,419,220 V232A possibly damaging Het
Sh3d21 T C 4: 126,151,152 E578G probably damaging Het
Tmem168 A T 6: 13,603,272 S32T probably damaging Het
Vmn1r38 T G 6: 66,776,530 I201L probably benign Het
Wfs1 C A 5: 36,975,544 W130C probably damaging Het
Other mutations in Dhrs13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0594:Dhrs13 UTSW 11 78034525 missense probably damaging 0.98
R0684:Dhrs13 UTSW 11 78036963 missense probably damaging 1.00
R4424:Dhrs13 UTSW 11 78037125 nonsense probably null
R5038:Dhrs13 UTSW 11 78032430 unclassified probably benign
R6151:Dhrs13 UTSW 11 78036982 missense probably damaging 1.00
R6306:Dhrs13 UTSW 11 78032693 missense probably damaging 0.97
R6765:Dhrs13 UTSW 11 78037139 missense probably benign
R7177:Dhrs13 UTSW 11 78034382 missense probably benign 0.05
R7525:Dhrs13 UTSW 11 78032434 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAAGCTCTGAGCCAAGGCTGGAC -3'
(R):5'- ATAGCAGGTAACACCAGTGCCCTC -3'

Sequencing Primer
(F):5'- TCATCCACAATGCAGGTGAG -3'
(R):5'- CTCAAGCTGGGTGGCAAG -3'
Posted On2013-11-08