Mutagenetix > Incidental Mutation

Incidental Mutation 'R0890:Setdb2'

83483

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

039053-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R0890 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59419220 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 232 (V232A)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095775
AA Change: V232A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: V232A

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111253

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161459
AA Change: V216A

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: V216A

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161959

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.1%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	C	7: 120,373,713	S837P	probably benign	Het
Cdh24	A	G	14: 54,632,594	V240A	probably benign	Het
Clcn4	T	C	7: 7,288,965	T556A	possibly damaging	Het
Coa7	G	A	4: 108,338,386	A171T	probably damaging	Het
Col12a1	A	T	9: 79,700,402	S381R	probably damaging	Het
Col9a3	C	T	2: 180,610,063	P335L	probably benign	Het
Dcxr	T	A	11: 120,726,471	N82I	probably damaging	Het
Dhdh	T	C	7: 45,481,971	D146G	possibly damaging	Het
Dhrs13	T	A	11: 78,034,350	L99Q	probably null	Het
Dnaic1	C	T	4: 41,604,253	T220M	possibly damaging	Het
Gapvd1	T	A	2: 34,712,317	D606V	probably damaging	Het
Gcn1l1	T	G	5: 115,579,793	C246G	possibly damaging	Het
Gdf10	A	G	14: 33,932,156	K207E	possibly damaging	Het
Gucy2d	T	C	7: 98,473,265	V1046A	probably benign	Het
Itpr3	C	A	17: 27,089,011	Y257*	probably null	Het
Kifc5b	C	T	17: 26,923,022	T158M	possibly damaging	Het
Klra7	C	T	6: 130,218,953	D251N	probably benign	Het
Mesp1	T	C	7: 79,792,935	D198G	probably benign	Het
Mrgprb8	T	A	7: 48,389,029	C149*	probably null	Het
Nphp4	C	A	4: 152,498,220	L169I	possibly damaging	Het
Olfr183	T	A	16: 58,999,787	I34K	possibly damaging	Het
Olfr3	T	A	2: 36,812,574	T173S	probably benign	Het
Olfr551	C	A	7: 102,588,201	E181*	probably null	Het
Pcgf5	A	T	19: 36,412,144	H7L	probably benign	Het
Polr3b	A	C	10: 84,714,336	K970T	probably benign	Het
Pomgnt1	A	G	4: 116,152,185	D93G	probably benign	Het
Rnf213	A	G	11: 119,430,486	K1256E	possibly damaging	Het
Scn9a	T	C	2: 66,483,735	T1869A	probably damaging	Het
Sh3d21	T	C	4: 126,151,152	E578G	probably damaging	Het
Tmem168	A	T	6: 13,603,272	S32T	probably damaging	Het
Vmn1r38	T	G	6: 66,776,530	I201L	probably benign	Het
Wfs1	C	A	5: 36,975,544	W130C	probably damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTATGCAGCCCTCAGAACAGTC -3'
(R):5'- CCCACTGTCCTTGAAGGGAGAAAAC -3'

Sequencing Primer
(F):5'- CTCAGAACAGTCACATGAATCAG -3'
(R):5'- CTTGAAGGGAGAAAACCCCCTG -3'

Posted On

2013-11-08