Incidental Mutation 'R0891:Smarcal1'
ID 83488
Institutional Source Beutler Lab
Gene Symbol Smarcal1
Ensembl Gene ENSMUSG00000039354
Gene Name SWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms Mharp, 6030401P21Rik
MMRRC Submission 039054-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0891 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 72622410-72672293 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72638015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 483 (V483A)
Ref Sequence ENSEMBL: ENSMUSP00000137833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000133123] [ENSMUST00000152225]
AlphaFold Q8BJL0
Predicted Effect probably damaging
Transcript: ENSMUST00000047615
AA Change: V483A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354
AA Change: V483A

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 3.6e-26 PFAM
Pfam:HARP 302 356 1.2e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133123
SMART Domains Protein: ENSMUSP00000114848
Gene: ENSMUSG00000039354

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 66 106 1.7e-14 PFAM
Pfam:HARP 140 194 2.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150725
Predicted Effect probably damaging
Transcript: ENSMUST00000152225
AA Change: V483A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354
AA Change: V483A

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 8e-29 PFAM
Pfam:HARP 302 356 3e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156797
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 92.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,884,156 (GRCm39) N567K possibly damaging Het
Afap1 G A 5: 36,119,196 (GRCm39) probably null Het
Angel2 G T 1: 190,677,270 (GRCm39) K517N possibly damaging Het
Ankrd36 A G 11: 5,637,316 (GRCm39) E1295G possibly damaging Het
Ankrd45 A G 1: 160,982,906 (GRCm39) N139S possibly damaging Het
Ano3 T C 2: 110,528,321 (GRCm39) T498A probably benign Het
Arhgap12 T C 18: 6,026,699 (GRCm39) T720A probably damaging Het
Brd10 G A 19: 29,695,053 (GRCm39) T1547I probably damaging Het
Brsk1 A G 7: 4,707,226 (GRCm39) S260G possibly damaging Het
Calml3 A G 13: 3,853,926 (GRCm39) F93S probably damaging Het
Ccnf G T 17: 24,445,751 (GRCm39) H498Q possibly damaging Het
Col27a1 A C 4: 63,223,420 (GRCm39) probably null Het
Cpne5 A G 17: 29,421,893 (GRCm39) probably benign Het
Dcst1 G A 3: 89,260,584 (GRCm39) T560I probably benign Het
Fndc7 A G 3: 108,777,904 (GRCm39) Y351H possibly damaging Het
Gen1 A G 12: 11,298,355 (GRCm39) probably benign Het
Kcnh8 A T 17: 53,212,242 (GRCm39) D680V probably damaging Het
Kmt2d A G 15: 98,750,572 (GRCm39) probably benign Het
Lrrfip1 T A 1: 90,996,337 (GRCm39) I50N probably damaging Het
Mbip A T 12: 56,387,242 (GRCm39) D132E possibly damaging Het
Nipal3 A T 4: 135,195,898 (GRCm39) I235N possibly damaging Het
Nup93 T A 8: 95,007,891 (GRCm39) probably benign Het
Or6b13 A G 7: 139,782,372 (GRCm39) Y104H probably damaging Het
Or6z6 T A 7: 6,491,471 (GRCm39) Y134F probably damaging Het
Pgbd1 T C 13: 21,606,970 (GRCm39) Y408C probably damaging Het
Pigo G A 4: 43,020,519 (GRCm39) Q808* probably null Het
Pik3r1 A T 13: 101,837,974 (GRCm39) N299K probably benign Het
Pip5k1a A G 3: 94,972,831 (GRCm39) probably benign Het
Semp2l1 T A 1: 32,585,442 (GRCm39) H156L possibly damaging Het
Septin5 G C 16: 18,443,595 (GRCm39) T118R probably damaging Het
Togaram1 A G 12: 65,029,421 (GRCm39) D948G probably benign Het
Vmn2r75 A T 7: 85,813,476 (GRCm39) V442E possibly damaging Het
Zfp57 A G 17: 37,317,068 (GRCm39) K46E probably damaging Het
Other mutations in Smarcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Smarcal1 APN 1 72,655,724 (GRCm39) missense possibly damaging 0.80
IGL01658:Smarcal1 APN 1 72,625,290 (GRCm39) missense probably benign 0.00
IGL01980:Smarcal1 APN 1 72,655,679 (GRCm39) nonsense probably null
IGL02007:Smarcal1 APN 1 72,635,099 (GRCm39) missense probably damaging 0.98
IGL02153:Smarcal1 APN 1 72,672,214 (GRCm39) utr 3 prime probably benign
IGL02496:Smarcal1 APN 1 72,659,247 (GRCm39) missense probably damaging 1.00
IGL03084:Smarcal1 APN 1 72,638,094 (GRCm39) splice site probably null
IGL03135:Smarcal1 APN 1 72,655,660 (GRCm39) splice site probably null
IGL03306:Smarcal1 APN 1 72,665,625 (GRCm39) missense probably benign 0.12
R0133:Smarcal1 UTSW 1 72,672,010 (GRCm39) missense probably benign 0.05
R0315:Smarcal1 UTSW 1 72,634,970 (GRCm39) nonsense probably null
R0396:Smarcal1 UTSW 1 72,665,632 (GRCm39) missense probably benign 0.03
R1799:Smarcal1 UTSW 1 72,625,120 (GRCm39) missense probably damaging 0.97
R1854:Smarcal1 UTSW 1 72,625,258 (GRCm39) missense possibly damaging 0.77
R3725:Smarcal1 UTSW 1 72,665,755 (GRCm39) missense possibly damaging 0.88
R3726:Smarcal1 UTSW 1 72,665,755 (GRCm39) missense possibly damaging 0.88
R4164:Smarcal1 UTSW 1 72,665,848 (GRCm39) intron probably benign
R4438:Smarcal1 UTSW 1 72,650,637 (GRCm39) intron probably benign
R4722:Smarcal1 UTSW 1 72,650,496 (GRCm39) missense probably damaging 1.00
R4796:Smarcal1 UTSW 1 72,636,599 (GRCm39) missense probably benign
R4989:Smarcal1 UTSW 1 72,672,019 (GRCm39) missense possibly damaging 0.84
R5242:Smarcal1 UTSW 1 72,630,242 (GRCm39) missense probably benign 0.00
R5367:Smarcal1 UTSW 1 72,635,135 (GRCm39) critical splice donor site probably null
R5418:Smarcal1 UTSW 1 72,638,068 (GRCm39) missense probably benign 0.01
R5430:Smarcal1 UTSW 1 72,665,776 (GRCm39) missense probably damaging 1.00
R5591:Smarcal1 UTSW 1 72,630,412 (GRCm39) missense probably damaging 1.00
R5607:Smarcal1 UTSW 1 72,625,372 (GRCm39) missense probably benign 0.00
R5809:Smarcal1 UTSW 1 72,630,296 (GRCm39) missense probably benign 0.09
R6395:Smarcal1 UTSW 1 72,655,716 (GRCm39) missense possibly damaging 0.82
R6447:Smarcal1 UTSW 1 72,625,033 (GRCm39) missense probably damaging 0.96
R6852:Smarcal1 UTSW 1 72,630,332 (GRCm39) missense possibly damaging 0.75
R7060:Smarcal1 UTSW 1 72,652,101 (GRCm39) missense probably damaging 1.00
R7692:Smarcal1 UTSW 1 72,625,179 (GRCm39) missense probably benign 0.08
R7975:Smarcal1 UTSW 1 72,652,150 (GRCm39) missense probably benign 0.08
R8232:Smarcal1 UTSW 1 72,665,722 (GRCm39) missense probably damaging 1.00
R8407:Smarcal1 UTSW 1 72,640,554 (GRCm39) missense probably benign 0.04
R8901:Smarcal1 UTSW 1 72,624,939 (GRCm39) missense possibly damaging 0.71
R9329:Smarcal1 UTSW 1 72,665,697 (GRCm39) missense probably damaging 0.99
R9548:Smarcal1 UTSW 1 72,671,999 (GRCm39) missense possibly damaging 0.84
Z1177:Smarcal1 UTSW 1 72,630,426 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACCAGAGTGTGTTAGATGCAG -3'
(R):5'- GGGCGGACTAGAAACCTTTGAACAG -3'

Sequencing Primer
(F):5'- ACTGTGTCTTCAGGGAAGGTTAAAC -3'
(R):5'- TCCTCAGGAAAGTCTGGCAC -3'
Posted On 2013-11-08