Incidental Mutation 'R0891:Pigo'
ID83496
Institutional Source Beutler Lab
Gene Symbol Pigo
Ensembl Gene ENSMUSG00000028454
Gene Namephosphatidylinositol glycan anchor biosynthesis, class O
Synonyms
MMRRC Submission 039054-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0891 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43017635-43025819 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 43020519 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 808 (Q808*)
Ref Sequence ENSEMBL: ENSMUSP00000095713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067481] [ENSMUST00000098109]
Predicted Effect probably null
Transcript: ENSMUST00000067481
AA Change: Q800*
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454
AA Change: Q800*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098109
AA Change: Q808*
SMART Domains Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454
AA Change: Q808*

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Phosphodiest 129 304 6.5e-18 PFAM
low complexity region 316 329 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 517 536 N/A INTRINSIC
low complexity region 547 567 N/A INTRINSIC
transmembrane domain 677 696 N/A INTRINSIC
transmembrane domain 711 730 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 866 888 N/A INTRINSIC
transmembrane domain 953 972 N/A INTRINSIC
low complexity region 987 1011 N/A INTRINSIC
transmembrane domain 1024 1046 N/A INTRINSIC
transmembrane domain 1061 1083 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131506
Predicted Effect probably benign
Transcript: ENSMUST00000149333
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155429
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 92.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,290 N567K possibly damaging Het
9930021J03Rik G A 19: 29,717,653 T1547I probably damaging Het
Afap1 G A 5: 35,961,852 probably null Het
Angel2 G T 1: 190,945,073 K517N possibly damaging Het
Ankrd36 A G 11: 5,687,316 E1295G possibly damaging Het
Ankrd45 A G 1: 161,155,336 N139S possibly damaging Het
Ano3 T C 2: 110,697,976 T498A probably benign Het
Arhgap12 T C 18: 6,026,699 T720A probably damaging Het
Brsk1 A G 7: 4,704,227 S260G possibly damaging Het
Calml3 A G 13: 3,803,926 F93S probably damaging Het
Ccnf G T 17: 24,226,777 H498Q possibly damaging Het
Col27a1 A C 4: 63,305,183 probably null Het
Cpne5 A G 17: 29,202,919 probably benign Het
Dcst1 G A 3: 89,353,277 T560I probably benign Het
Fndc7 A G 3: 108,870,588 Y351H possibly damaging Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm5415 T A 1: 32,546,361 H156L possibly damaging Het
Kcnh8 A T 17: 52,905,214 D680V probably damaging Het
Kmt2d A G 15: 98,852,691 probably benign Het
Lrrfip1 T A 1: 91,068,615 I50N probably damaging Het
Mbip A T 12: 56,340,457 D132E possibly damaging Het
Nipal3 A T 4: 135,468,587 I235N possibly damaging Het
Nup93 T A 8: 94,281,263 probably benign Het
Olfr1347 T A 7: 6,488,472 Y134F probably damaging Het
Olfr524 A G 7: 140,202,459 Y104H probably damaging Het
Pgbd1 T C 13: 21,422,800 Y408C probably damaging Het
Pik3r1 A T 13: 101,701,466 N299K probably benign Het
Pip5k1a A G 3: 95,065,520 probably benign Het
Sept5 G C 16: 18,624,845 T118R probably damaging Het
Smarcal1 T C 1: 72,598,856 V483A probably damaging Het
Togaram1 A G 12: 64,982,647 D948G probably benign Het
Vmn2r75 A T 7: 86,164,268 V442E possibly damaging Het
Zfp57 A G 17: 37,006,176 K46E probably damaging Het
Other mutations in Pigo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Pigo APN 4 43021767 missense possibly damaging 0.63
IGL02176:Pigo APN 4 43019352 missense probably benign 0.20
IGL03197:Pigo APN 4 43022103 missense possibly damaging 0.92
R0207:Pigo UTSW 4 43023824 splice site probably benign
R0464:Pigo UTSW 4 43019814 missense probably benign 0.02
R1445:Pigo UTSW 4 43021460 missense probably benign
R1484:Pigo UTSW 4 43024779 missense probably damaging 0.99
R1547:Pigo UTSW 4 43020689 missense probably benign 0.01
R1624:Pigo UTSW 4 43024661 missense probably damaging 1.00
R1847:Pigo UTSW 4 43024710 nonsense probably null
R3110:Pigo UTSW 4 43021083 missense probably benign 0.00
R3111:Pigo UTSW 4 43021083 missense probably benign 0.00
R3112:Pigo UTSW 4 43021083 missense probably benign 0.00
R3824:Pigo UTSW 4 43020909 missense possibly damaging 0.95
R3850:Pigo UTSW 4 43025084 missense probably benign 0.01
R3980:Pigo UTSW 4 43019231 missense probably damaging 1.00
R3982:Pigo UTSW 4 43023482 missense probably benign 0.00
R4520:Pigo UTSW 4 43020301 missense probably benign 0.16
R5033:Pigo UTSW 4 43019412 missense probably null 1.00
R5054:Pigo UTSW 4 43021337 missense probably damaging 1.00
R5240:Pigo UTSW 4 43020675 missense possibly damaging 0.95
R5390:Pigo UTSW 4 43019645 critical splice donor site probably null
R5468:Pigo UTSW 4 43024562 critical splice donor site probably null
R5775:Pigo UTSW 4 43023475 missense probably damaging 1.00
R5839:Pigo UTSW 4 43022104 missense probably damaging 1.00
R5924:Pigo UTSW 4 43023389 nonsense probably null
R6111:Pigo UTSW 4 43019724 missense probably benign 0.18
R6451:Pigo UTSW 4 43021412 missense probably benign
R6533:Pigo UTSW 4 43022697 missense probably benign 0.07
R6884:Pigo UTSW 4 43022627 missense possibly damaging 0.88
R7026:Pigo UTSW 4 43023380 nonsense probably null
R7591:Pigo UTSW 4 43025093 missense probably benign
R7876:Pigo UTSW 4 43020671 missense probably benign 0.00
R7959:Pigo UTSW 4 43020671 missense probably benign 0.00
Z1088:Pigo UTSW 4 43019409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCGCTCTACATGCAACAG -3'
(R):5'- TGGCTTCGCCGCTATGGTAATCTC -3'

Sequencing Primer
(F):5'- GCTCTACATGCAACAGCATAAGTG -3'
(R):5'- CGCTATGGTAATCTCAAGAGTCCTG -3'
Posted On2013-11-08