Incidental Mutation 'R0891:Nup93'
ID 83506
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Name nucleoporin 93
Synonyms 2410008G02Rik
MMRRC Submission 039054-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.919) question?
Stock # R0891 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 94941192-95043855 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 95007891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212167] [ENSMUST00000212824]
AlphaFold Q8BJ71
Predicted Effect probably benign
Transcript: ENSMUST00000079961
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109547
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212137
Predicted Effect probably benign
Transcript: ENSMUST00000212167
Predicted Effect probably benign
Transcript: ENSMUST00000212824
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 92.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,884,156 (GRCm39) N567K possibly damaging Het
Afap1 G A 5: 36,119,196 (GRCm39) probably null Het
Angel2 G T 1: 190,677,270 (GRCm39) K517N possibly damaging Het
Ankrd36 A G 11: 5,637,316 (GRCm39) E1295G possibly damaging Het
Ankrd45 A G 1: 160,982,906 (GRCm39) N139S possibly damaging Het
Ano3 T C 2: 110,528,321 (GRCm39) T498A probably benign Het
Arhgap12 T C 18: 6,026,699 (GRCm39) T720A probably damaging Het
Brd10 G A 19: 29,695,053 (GRCm39) T1547I probably damaging Het
Brsk1 A G 7: 4,707,226 (GRCm39) S260G possibly damaging Het
Calml3 A G 13: 3,853,926 (GRCm39) F93S probably damaging Het
Ccnf G T 17: 24,445,751 (GRCm39) H498Q possibly damaging Het
Col27a1 A C 4: 63,223,420 (GRCm39) probably null Het
Cpne5 A G 17: 29,421,893 (GRCm39) probably benign Het
Dcst1 G A 3: 89,260,584 (GRCm39) T560I probably benign Het
Fndc7 A G 3: 108,777,904 (GRCm39) Y351H possibly damaging Het
Gen1 A G 12: 11,298,355 (GRCm39) probably benign Het
Kcnh8 A T 17: 53,212,242 (GRCm39) D680V probably damaging Het
Kmt2d A G 15: 98,750,572 (GRCm39) probably benign Het
Lrrfip1 T A 1: 90,996,337 (GRCm39) I50N probably damaging Het
Mbip A T 12: 56,387,242 (GRCm39) D132E possibly damaging Het
Nipal3 A T 4: 135,195,898 (GRCm39) I235N possibly damaging Het
Or6b13 A G 7: 139,782,372 (GRCm39) Y104H probably damaging Het
Or6z6 T A 7: 6,491,471 (GRCm39) Y134F probably damaging Het
Pgbd1 T C 13: 21,606,970 (GRCm39) Y408C probably damaging Het
Pigo G A 4: 43,020,519 (GRCm39) Q808* probably null Het
Pik3r1 A T 13: 101,837,974 (GRCm39) N299K probably benign Het
Pip5k1a A G 3: 94,972,831 (GRCm39) probably benign Het
Semp2l1 T A 1: 32,585,442 (GRCm39) H156L possibly damaging Het
Septin5 G C 16: 18,443,595 (GRCm39) T118R probably damaging Het
Smarcal1 T C 1: 72,638,015 (GRCm39) V483A probably damaging Het
Togaram1 A G 12: 65,029,421 (GRCm39) D948G probably benign Het
Vmn2r75 A T 7: 85,813,476 (GRCm39) V442E possibly damaging Het
Zfp57 A G 17: 37,317,068 (GRCm39) K46E probably damaging Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 95,035,651 (GRCm39) critical splice donor site probably null
IGL01652:Nup93 APN 8 95,023,187 (GRCm39) missense possibly damaging 0.93
IGL02003:Nup93 APN 8 95,028,737 (GRCm39) nonsense probably null
IGL02169:Nup93 APN 8 95,028,757 (GRCm39) missense probably damaging 1.00
IGL02212:Nup93 APN 8 95,038,290 (GRCm39) critical splice donor site probably null
IGL02551:Nup93 APN 8 94,954,461 (GRCm39) nonsense probably null
IGL02568:Nup93 APN 8 95,036,263 (GRCm39) missense probably damaging 1.00
IGL03094:Nup93 APN 8 95,023,130 (GRCm39) missense probably benign
IGL03248:Nup93 APN 8 95,032,716 (GRCm39) missense probably damaging 0.98
IGL03273:Nup93 APN 8 95,032,905 (GRCm39) missense probably benign 0.01
IGL03401:Nup93 APN 8 95,036,339 (GRCm39) splice site probably null
PIT4585001:Nup93 UTSW 8 94,970,355 (GRCm39) missense probably benign 0.25
R0409:Nup93 UTSW 8 95,030,293 (GRCm39) missense probably damaging 1.00
R0748:Nup93 UTSW 8 95,034,571 (GRCm39) missense probably damaging 1.00
R1667:Nup93 UTSW 8 95,019,315 (GRCm39) missense possibly damaging 0.71
R1696:Nup93 UTSW 8 95,023,183 (GRCm39) missense probably benign 0.29
R1862:Nup93 UTSW 8 95,032,730 (GRCm39) missense probably damaging 1.00
R2069:Nup93 UTSW 8 94,970,367 (GRCm39) missense probably damaging 1.00
R2143:Nup93 UTSW 8 95,023,108 (GRCm39) nonsense probably null
R2187:Nup93 UTSW 8 95,027,478 (GRCm39) missense probably damaging 1.00
R2228:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2229:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2254:Nup93 UTSW 8 94,954,485 (GRCm39) critical splice donor site probably null
R2884:Nup93 UTSW 8 95,030,266 (GRCm39) missense probably damaging 1.00
R4521:Nup93 UTSW 8 95,041,264 (GRCm39) missense probably damaging 1.00
R4563:Nup93 UTSW 8 95,034,520 (GRCm39) missense probably damaging 1.00
R4900:Nup93 UTSW 8 95,013,231 (GRCm39) missense probably benign 0.25
R5570:Nup93 UTSW 8 95,041,298 (GRCm39) missense probably damaging 1.00
R6226:Nup93 UTSW 8 95,013,165 (GRCm39) missense probably damaging 1.00
R6489:Nup93 UTSW 8 95,028,716 (GRCm39) missense probably benign 0.10
R6658:Nup93 UTSW 8 95,030,807 (GRCm39) missense probably benign 0.02
R6817:Nup93 UTSW 8 95,041,310 (GRCm39) critical splice donor site probably null
R6895:Nup93 UTSW 8 94,970,314 (GRCm39) missense probably damaging 1.00
R6955:Nup93 UTSW 8 95,036,301 (GRCm39) missense probably damaging 0.96
R7476:Nup93 UTSW 8 95,030,260 (GRCm39) missense probably damaging 1.00
R7643:Nup93 UTSW 8 95,013,247 (GRCm39) critical splice donor site probably null
R7994:Nup93 UTSW 8 95,032,930 (GRCm39) missense probably benign 0.15
R8461:Nup93 UTSW 8 95,007,963 (GRCm39) critical splice donor site probably null
R9177:Nup93 UTSW 8 94,954,371 (GRCm39) missense probably benign 0.25
R9264:Nup93 UTSW 8 95,019,348 (GRCm39) missense probably benign 0.01
R9532:Nup93 UTSW 8 95,041,249 (GRCm39) missense probably damaging 1.00
R9567:Nup93 UTSW 8 95,035,604 (GRCm39) missense possibly damaging 0.94
R9629:Nup93 UTSW 8 95,033,267 (GRCm39) missense probably damaging 0.99
R9721:Nup93 UTSW 8 95,030,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGAGGCACTAGGCTTTGGC -3'
(R):5'- ACAATGGCTGCTCTGGGTGATG -3'

Sequencing Primer
(F):5'- CCATTTGGCCTGCAAActtcc -3'
(R):5'- aggaaataaccaacccacaaaag -3'
Posted On 2013-11-08