Incidental Mutation 'R0891:Sept5'
ID83515
Institutional Source Beutler Lab
Gene Symbol Sept5
Ensembl Gene ENSMUSG00000072214
Gene Nameseptin 5
SynonymsCdcrel1, Pnutl1
MMRRC Submission 039054-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R0891 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18620502-18629954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 18624845 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 118 (T118R)
Ref Sequence ENSEMBL: ENSMUSP00000156265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051160] [ENSMUST00000096987] [ENSMUST00000167388] [ENSMUST00000231244] [ENSMUST00000231335] [ENSMUST00000231622] [ENSMUST00000231956] [ENSMUST00000232653]
Predicted Effect probably benign
Transcript: ENSMUST00000051160
SMART Domains Protein: ENSMUSP00000059270
Gene: ENSMUSG00000050761

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
LRRNT 33 67 4.14e-11 SMART
low complexity region 75 94 N/A INTRINSIC
LRRCT 97 150 4.88e-14 SMART
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096987
AA Change: T109R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094750
Gene: ENSMUSG00000072214
AA Change: T109R

DomainStartEndE-ValueType
Pfam:Septin 41 321 1.2e-127 PFAM
Pfam:MMR_HSR1 46 190 5.1e-7 PFAM
low complexity region 355 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167388
SMART Domains Protein: ENSMUSP00000126292
Gene: ENSMUSG00000050761

DomainStartEndE-ValueType
LRRNT 25 59 4.14e-11 SMART
low complexity region 67 86 N/A INTRINSIC
LRRCT 89 142 4.88e-14 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231244
AA Change: T109R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231246
Predicted Effect probably damaging
Transcript: ENSMUST00000231335
AA Change: T118R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231400
Predicted Effect probably damaging
Transcript: ENSMUST00000231622
AA Change: T62R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231642
Predicted Effect probably damaging
Transcript: ENSMUST00000231956
AA Change: T109R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232152
Predicted Effect probably damaging
Transcript: ENSMUST00000232653
AA Change: T118R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9539 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 92.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene show no gross phenotypic changes. Partial defects in synaptic transmission is reported for one allele, and platelet secretion and modest behavioral defects reported for a different allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,290 N567K possibly damaging Het
9930021J03Rik G A 19: 29,717,653 T1547I probably damaging Het
Afap1 G A 5: 35,961,852 probably null Het
Angel2 G T 1: 190,945,073 K517N possibly damaging Het
Ankrd36 A G 11: 5,687,316 E1295G possibly damaging Het
Ankrd45 A G 1: 161,155,336 N139S possibly damaging Het
Ano3 T C 2: 110,697,976 T498A probably benign Het
Arhgap12 T C 18: 6,026,699 T720A probably damaging Het
Brsk1 A G 7: 4,704,227 S260G possibly damaging Het
Calml3 A G 13: 3,803,926 F93S probably damaging Het
Ccnf G T 17: 24,226,777 H498Q possibly damaging Het
Col27a1 A C 4: 63,305,183 probably null Het
Cpne5 A G 17: 29,202,919 probably benign Het
Dcst1 G A 3: 89,353,277 T560I probably benign Het
Fndc7 A G 3: 108,870,588 Y351H possibly damaging Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm5415 T A 1: 32,546,361 H156L possibly damaging Het
Kcnh8 A T 17: 52,905,214 D680V probably damaging Het
Kmt2d A G 15: 98,852,691 probably benign Het
Lrrfip1 T A 1: 91,068,615 I50N probably damaging Het
Mbip A T 12: 56,340,457 D132E possibly damaging Het
Nipal3 A T 4: 135,468,587 I235N possibly damaging Het
Nup93 T A 8: 94,281,263 probably benign Het
Olfr1347 T A 7: 6,488,472 Y134F probably damaging Het
Olfr524 A G 7: 140,202,459 Y104H probably damaging Het
Pgbd1 T C 13: 21,422,800 Y408C probably damaging Het
Pigo G A 4: 43,020,519 Q808* probably null Het
Pik3r1 A T 13: 101,701,466 N299K probably benign Het
Pip5k1a A G 3: 95,065,520 probably benign Het
Smarcal1 T C 1: 72,598,856 V483A probably damaging Het
Togaram1 A G 12: 64,982,647 D948G probably benign Het
Vmn2r75 A T 7: 86,164,268 V442E possibly damaging Het
Zfp57 A G 17: 37,006,176 K46E probably damaging Het
Other mutations in Sept5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Sept5 APN 16 18624930 missense probably damaging 1.00
IGL02124:Sept5 APN 16 18624829 missense probably damaging 0.98
IGL02211:Sept5 APN 16 18624879 missense probably damaging 1.00
IGL02934:Sept5 APN 16 18629831 missense probably damaging 0.99
R0518:Sept5 UTSW 16 18624897 missense probably benign 0.02
R0521:Sept5 UTSW 16 18624897 missense probably benign 0.02
R0627:Sept5 UTSW 16 18625365 missense possibly damaging 0.90
R0746:Sept5 UTSW 16 18623225 missense probably damaging 1.00
R1037:Sept5 UTSW 16 18623094 splice site probably benign
R1850:Sept5 UTSW 16 18625210 missense probably damaging 1.00
R2044:Sept5 UTSW 16 18623012 missense probably benign 0.10
R3872:Sept5 UTSW 16 18622973 missense probably damaging 0.98
R4498:Sept5 UTSW 16 18623392 missense probably damaging 1.00
R5503:Sept5 UTSW 16 18623368 missense probably benign 0.00
R5963:Sept5 UTSW 16 18624212 splice site probably null
R6286:Sept5 UTSW 16 18623377 missense probably damaging 0.99
R7014:Sept5 UTSW 16 18624909 missense probably damaging 1.00
R7909:Sept5 UTSW 16 18624622 missense probably damaging 1.00
R8708:Sept5 UTSW 16 18624872 missense probably benign 0.01
R8888:Sept5 UTSW 16 18623111 missense possibly damaging 0.81
R8895:Sept5 UTSW 16 18623111 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCCACTCTCATCACGGAAATACTGC -3'
(R):5'- TGGCCCGGAGTATACATTCAGACAG -3'

Sequencing Primer
(F):5'- GAAATACTGCTCAAACTGCTGGTC -3'
(R):5'- TTCAGACAGAGACTGAAGCC -3'
Posted On2013-11-08