Incidental Mutation 'R0892:Tatdn3'
ID83524
Institutional Source Beutler Lab
Gene Symbol Tatdn3
Ensembl Gene ENSMUSG00000026632
Gene NameTatD DNase domain containing 3
Synonyms
MMRRC Submission 039055-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0892 (G1)
Quality Score216
Status Not validated
Chromosome1
Chromosomal Location191045826-191062932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191062805 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 18 (D18G)
Ref Sequence ENSEMBL: ENSMUSP00000106518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027945] [ENSMUST00000076952] [ENSMUST00000078259] [ENSMUST00000085633] [ENSMUST00000110891] [ENSMUST00000110893] [ENSMUST00000139340]
Predicted Effect probably benign
Transcript: ENSMUST00000027945
AA Change: D18G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027945
Gene: ENSMUSG00000026632
AA Change: D18G

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 263 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076952
SMART Domains Protein: ENSMUSP00000076220
Gene: ENSMUSG00000062510

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 170 1.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078259
SMART Domains Protein: ENSMUSP00000077380
Gene: ENSMUSG00000062510

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 82 197 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085633
AA Change: D18G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082773
Gene: ENSMUSG00000026632
AA Change: D18G

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 170 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110891
AA Change: D18G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106516
Gene: ENSMUSG00000026632
AA Change: D18G

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 231 2.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110893
AA Change: D18G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106518
Gene: ENSMUSG00000026632
AA Change: D18G

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 264 1.8e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124497
Predicted Effect probably benign
Transcript: ENSMUST00000139340
SMART Domains Protein: ENSMUSP00000115289
Gene: ENSMUSG00000062510

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 171 7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156527
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,382,248 probably null Het
Abca13 T A 11: 9,298,305 V2684E probably benign Het
Ankub1 T C 3: 57,690,379 R57G probably benign Het
Bcr C T 10: 75,125,063 A442V probably benign Het
Cd46 T C 1: 195,082,612 T226A possibly damaging Het
Dmkn C T 7: 30,767,404 R114C probably damaging Het
Ell2 A T 13: 75,763,639 N348I probably damaging Het
Epg5 T A 18: 77,968,628 I830N possibly damaging Het
Gm15737 C T 6: 92,879,740 probably benign Het
Gpa33 A G 1: 166,157,642 N182S probably damaging Het
Gpr37 A T 6: 25,688,207 I297N probably damaging Het
Hpse2 T C 19: 43,388,146 K56E probably benign Het
Lamc1 G A 1: 153,332,254 H96Y possibly damaging Het
Mapre2 A G 18: 23,858,143 N189S probably benign Het
Msmo1 T A 8: 64,722,553 I148F possibly damaging Het
Myh6 T C 14: 54,947,054 T1607A probably benign Het
Olfr1484 T A 19: 13,585,517 V28D probably damaging Het
Oog2 A T 4: 144,196,499 T445S probably benign Het
Plag1 G A 4: 3,904,532 Q220* probably null Het
Pom121l2 A G 13: 21,982,474 E305G possibly damaging Het
Sbsn A T 7: 30,754,819 Q50L possibly damaging Het
Slc25a42 A G 8: 70,191,947 L34P probably damaging Het
Sptbn1 C A 11: 30,142,201 R521S probably damaging Het
St14 A T 9: 31,100,428 V394E probably benign Het
Trappc8 A G 18: 20,831,608 probably null Het
Other mutations in Tatdn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Tatdn3 APN 1 191055381 splice site probably benign
IGL02819:Tatdn3 APN 1 191055344 missense probably benign 0.04
IGL02898:Tatdn3 APN 1 191046310 makesense probably null
R0718:Tatdn3 UTSW 1 191052849 splice site probably benign
R1635:Tatdn3 UTSW 1 191060176 missense probably benign
R2018:Tatdn3 UTSW 1 191049280 critical splice donor site probably null
R2088:Tatdn3 UTSW 1 191052876 missense possibly damaging 0.59
R2243:Tatdn3 UTSW 1 191052900 missense probably damaging 1.00
R3933:Tatdn3 UTSW 1 191046324 splice site probably null
R4676:Tatdn3 UTSW 1 191049334 missense probably damaging 1.00
R5047:Tatdn3 UTSW 1 191046278 missense probably damaging 1.00
R5923:Tatdn3 UTSW 1 191049310 missense probably damaging 1.00
R6044:Tatdn3 UTSW 1 191056361 critical splice donor site probably null
R6066:Tatdn3 UTSW 1 191046268 missense probably benign 0.24
R7770:Tatdn3 UTSW 1 191058856 missense probably benign 0.05
R8331:Tatdn3 UTSW 1 191046211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCACACCTCAAGAGTGGTAGG -3'
(R):5'- TTTCAGAGACAGCCGCCATCTTCC -3'

Sequencing Primer
(F):5'- GTTGAGACGACAAACTAAAGCTTC -3'
(R):5'- GAAGGATGCTTCCCTCCCTG -3'
Posted On2013-11-08