Incidental Mutation 'R0892:Olfr1484'
ID83552
Institutional Source Beutler Lab
Gene Symbol Olfr1484
Ensembl Gene ENSMUSG00000096289
Gene Nameolfactory receptor 1484
SynonymsMOR202-37, GA_x6K02T2RE5P-3917859-3918806
MMRRC Submission 039055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0892 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13583511-13588832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13585517 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 28 (V28D)
Ref Sequence ENSEMBL: ENSMUSP00000150640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074180] [ENSMUST00000207093] [ENSMUST00000208104] [ENSMUST00000215567] [ENSMUST00000216014] [ENSMUST00000216369] [ENSMUST00000217451]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074180
AA Change: V71D

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073811
Gene: ENSMUSG00000096289
AA Change: V71D

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 7.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.1e-5 PFAM
Pfam:7tm_1 40 289 3.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207093
AA Change: V71D
Predicted Effect probably damaging
Transcript: ENSMUST00000208104
AA Change: V28D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208420
Predicted Effect possibly damaging
Transcript: ENSMUST00000215567
AA Change: V71D

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216014
AA Change: V71D

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000216369
AA Change: V28D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217451
AA Change: V71D

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,382,248 probably null Het
Abca13 T A 11: 9,298,305 V2684E probably benign Het
Ankub1 T C 3: 57,690,379 R57G probably benign Het
Bcr C T 10: 75,125,063 A442V probably benign Het
Cd46 T C 1: 195,082,612 T226A possibly damaging Het
Dmkn C T 7: 30,767,404 R114C probably damaging Het
Ell2 A T 13: 75,763,639 N348I probably damaging Het
Epg5 T A 18: 77,968,628 I830N possibly damaging Het
Gm15737 C T 6: 92,879,740 probably benign Het
Gpa33 A G 1: 166,157,642 N182S probably damaging Het
Gpr37 A T 6: 25,688,207 I297N probably damaging Het
Hpse2 T C 19: 43,388,146 K56E probably benign Het
Lamc1 G A 1: 153,332,254 H96Y possibly damaging Het
Mapre2 A G 18: 23,858,143 N189S probably benign Het
Msmo1 T A 8: 64,722,553 I148F possibly damaging Het
Myh6 T C 14: 54,947,054 T1607A probably benign Het
Oog2 A T 4: 144,196,499 T445S probably benign Het
Plag1 G A 4: 3,904,532 Q220* probably null Het
Pom121l2 A G 13: 21,982,474 E305G possibly damaging Het
Sbsn A T 7: 30,754,819 Q50L possibly damaging Het
Slc25a42 A G 8: 70,191,947 L34P probably damaging Het
Sptbn1 C A 11: 30,142,201 R521S probably damaging Het
St14 A T 9: 31,100,428 V394E probably benign Het
Tatdn3 T C 1: 191,062,805 D18G probably benign Het
Trappc8 A G 18: 20,831,608 probably null Het
Other mutations in Olfr1484
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Olfr1484 APN 19 13586104 missense probably benign 0.05
IGL02104:Olfr1484 APN 19 13585604 missense probably damaging 0.99
IGL02502:Olfr1484 APN 19 13585748 missense probably damaging 1.00
IGL03339:Olfr1484 APN 19 13586075 missense probably damaging 0.99
IGL03391:Olfr1484 APN 19 13586119 missense probably benign
R0008:Olfr1484 UTSW 19 13585876 missense probably benign 0.01
R0607:Olfr1484 UTSW 19 13586170 missense probably damaging 1.00
R1170:Olfr1484 UTSW 19 13586213 missense probably benign 0.00
R1605:Olfr1484 UTSW 19 13585630 missense probably benign 0.00
R1619:Olfr1484 UTSW 19 13585614 missense probably benign 0.03
R1793:Olfr1484 UTSW 19 13585415 missense probably benign 0.42
R2073:Olfr1484 UTSW 19 13585601 missense probably damaging 1.00
R2348:Olfr1484 UTSW 19 13586189 missense probably damaging 0.99
R5025:Olfr1484 UTSW 19 13585522 missense probably benign 0.03
R5383:Olfr1484 UTSW 19 13586075 missense probably damaging 0.99
R5771:Olfr1484 UTSW 19 13585508 missense probably damaging 0.98
R6002:Olfr1484 UTSW 19 13585417 start gained probably benign
R6992:Olfr1484 UTSW 19 13585447 missense possibly damaging 0.57
R7404:Olfr1484 UTSW 19 13585388 missense possibly damaging 0.88
R8358:Olfr1484 UTSW 19 13585400 missense probably damaging 0.97
RF002:Olfr1484 UTSW 19 13586051 missense probably damaging 1.00
X0019:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0019:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0040:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0040:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0067:Olfr1484 UTSW 19 13586072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTTAACAGATGCACCATTCCTG -3'
(R):5'- TCTCAGCAGAGCGCATTCTCAC -3'

Sequencing Primer
(F):5'- GATGCACCATTCCTGCAAACTC -3'
(R):5'- GAGCGCATTCTCACAATTGC -3'
Posted On2013-11-08