Incidental Mutation 'R0893:Elp4'
ID83563
Institutional Source Beutler Lab
Gene Symbol Elp4
Ensembl Gene ENSMUSG00000027167
Gene Nameelongator acetyltransferase complex subunit 4
SynonymsA330107A17Rik, Paxneb
MMRRC Submission 039056-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0893 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location105701027-105904564 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 105896945 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122965]
Predicted Effect probably benign
Transcript: ENSMUST00000122965
SMART Domains Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167

DomainStartEndE-ValueType
Pfam:PAXNEB 28 422 4e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148441
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. This gene has also been associated with Rolandic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,219,308 probably benign Het
4921501E09Rik T C 17: 33,065,289 I846M probably benign Het
Adnp A T 2: 168,183,727 F549L possibly damaging Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Aldh8a1 T A 10: 21,391,694 M326K probably benign Het
Amdhd1 A T 10: 93,527,651 M295K probably damaging Het
Arhgef4 T A 1: 34,807,110 C324S probably damaging Het
Car8 A T 4: 8,238,119 probably null Het
Cc2d1a T C 8: 84,140,839 probably benign Het
Cd81 G A 7: 143,062,505 V27M possibly damaging Het
Ces1b A T 8: 93,079,428 S62T probably benign Het
Cfb A G 17: 34,858,055 S30P probably damaging Het
Cmtm3 A G 8: 104,343,911 M101V possibly damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Ddb1 C T 19: 10,612,916 S269L probably benign Het
Ddx25 G A 9: 35,554,390 Q143* probably null Het
Dis3l2 T A 1: 87,044,206 probably null Het
Dlgap4 G T 2: 156,745,978 E598* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Eya3 A G 4: 132,689,786 N194S probably benign Het
Gm9992 A G 17: 7,374,527 L174P probably damaging Het
Golgb1 G T 16: 36,912,277 V629L possibly damaging Het
Hars2 G A 18: 36,787,595 A164T possibly damaging Het
Hexb T A 13: 97,185,627 I217L probably benign Het
Hgh1 A G 15: 76,369,648 probably null Het
Hsd3b3 A T 3: 98,742,441 probably null Het
Ighg2c T A 12: 113,287,433 N321Y unknown Het
Il5 A G 11: 53,720,936 T34A probably benign Het
Jph1 C A 1: 17,004,283 E504* probably null Het
Kif2b G T 11: 91,575,594 T621K probably benign Het
Kmt2c A T 5: 25,351,270 probably benign Het
Leprotl1 A G 8: 34,138,852 probably null Het
Lpar3 C T 3: 146,240,593 R9C possibly damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Map2 C A 1: 66,380,768 T86K probably damaging Het
Map7 A G 10: 20,273,883 probably null Het
Mdn1 T C 4: 32,701,713 V1482A probably benign Het
Mks1 G A 11: 87,856,951 probably benign Het
Morf4l1 T G 9: 90,102,350 K102N probably damaging Het
Mroh1 T A 15: 76,408,938 V304D possibly damaging Het
Mtg1 G A 7: 140,149,752 V252M probably damaging Het
Myh13 A T 11: 67,334,601 D264V probably damaging Het
Myh2 A G 11: 67,186,508 Y823C possibly damaging Het
Myoz1 A T 14: 20,651,184 S112R probably benign Het
Ncapd2 A G 6: 125,173,482 V860A probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Npffr1 T C 10: 61,614,231 F95L possibly damaging Het
Olfr585 G T 7: 103,098,434 R231L probably benign Het
Olfr877 T C 9: 37,855,196 I126T probably damaging Het
Orc4 A C 2: 48,932,610 probably benign Het
P3h3 A C 6: 124,845,513 I565R probably damaging Het
Pak4 T C 7: 28,559,777 D552G probably benign Het
Pcdhb4 G T 18: 37,309,370 probably null Het
Pdcd4 G T 19: 53,929,094 R454L probably damaging Het
Pkd1l2 A G 8: 117,044,492 I1116T probably damaging Het
Plcb2 A G 2: 118,725,105 probably benign Het
Pmpca T C 2: 26,393,218 probably benign Het
Pnpla7 T A 2: 24,997,240 I32N probably damaging Het
Prpf8 A G 11: 75,493,949 K718E probably damaging Het
Racgap1 C T 15: 99,626,530 A359T probably benign Het
Rgs3 G A 4: 62,605,561 probably null Het
Rhpn1 A G 15: 75,711,654 E356G probably damaging Het
Rps6ka5 T C 12: 100,574,438 H488R possibly damaging Het
Scn11a A G 9: 119,803,330 probably null Het
Sema4f A T 6: 82,935,967 probably benign Het
Serpina1f A G 12: 103,693,835 S63P probably damaging Het
Slc9a3 T C 13: 74,159,246 W386R probably damaging Het
Slc9b1 A C 3: 135,394,890 L465F probably benign Het
Smc5 A G 19: 23,263,653 V165A possibly damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tinagl1 G T 4: 130,174,023 D59E probably damaging Het
Tns3 A G 11: 8,493,302 Y354H probably damaging Het
Trappc9 C T 15: 72,590,107 G1103D probably damaging Het
Unc79 A T 12: 102,991,428 D34V probably damaging Het
Unc80 T C 1: 66,521,486 L791P probably damaging Het
Xpo7 G T 14: 70,666,097 probably benign Het
Zbtb1 T A 12: 76,385,339 I33N probably damaging Het
Other mutations in Elp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Elp4 APN 2 105842366 splice site probably benign
IGL01407:Elp4 APN 2 105792308 missense probably damaging 1.00
IGL02173:Elp4 APN 2 105702743 missense probably damaging 0.96
IGL02370:Elp4 APN 2 105794592 missense probably damaging 1.00
R0125:Elp4 UTSW 2 105792214 critical splice donor site probably null
R0685:Elp4 UTSW 2 105792277 missense possibly damaging 0.94
R1117:Elp4 UTSW 2 105842311 missense probably benign 0.00
R1496:Elp4 UTSW 2 105832161 missense probably benign 0.31
R1542:Elp4 UTSW 2 105794609 missense probably benign 0.02
R1911:Elp4 UTSW 2 105702743 missense probably damaging 0.96
R2311:Elp4 UTSW 2 105842332 missense probably benign 0.00
R2997:Elp4 UTSW 2 105814316 missense possibly damaging 0.82
R3079:Elp4 UTSW 2 105809445 missense possibly damaging 0.95
R3683:Elp4 UTSW 2 105702761 missense possibly damaging 0.75
R4747:Elp4 UTSW 2 105794607 missense probably damaging 1.00
R4799:Elp4 UTSW 2 105809267 missense probably damaging 0.99
R5438:Elp4 UTSW 2 105904403 missense probably damaging 1.00
R5635:Elp4 UTSW 2 105814264 critical splice donor site probably null
R6414:Elp4 UTSW 2 105904443 missense possibly damaging 0.94
R7228:Elp4 UTSW 2 105792302 missense probably damaging 1.00
R7381:Elp4 UTSW 2 105792307 missense not run
R7560:Elp4 UTSW 2 105794588 missense probably damaging 1.00
R7671:Elp4 UTSW 2 105904481 missense probably damaging 0.99
R8376:Elp4 UTSW 2 105842308 missense probably benign 0.00
R8918:Elp4 UTSW 2 105832255 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CGCTGAAATATGCCACATTGAGCTG -3'
(R):5'- AGCTGTATTGAGTGCCTCCTGGTTA -3'

Sequencing Primer
(F):5'- GGACAAAAATCTGGCCTACTTTGC -3'
(R):5'- CCTGGTTATGTCAGGAGGAAAG -3'
Posted On2013-11-08