Mutagenetix > Incidental Mutation

Incidental Mutation 'R0893:Elp4'

83563

Institutional Source

Beutler Lab

Gene Symbol

Elp4

Ensembl Gene

ENSMUSG00000027167

Gene Name

elongator acetyltransferase complex subunit 4

Synonyms

A330107A17Rik, Paxneb

MMRRC Submission

039056-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R0893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105701027-105904564 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 105896945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116575 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122965]

AlphaFold

Q9ER73

Predicted Effect

probably benign
Transcript: ENSMUST00000122965

SMART Domains

Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167

Domain	Start	End	E-Value	Type
Pfam:PAXNEB	28	422	4e-123	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148441

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. This gene has also been associated with Rolandic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,219,308		probably benign	Het
4921501E09Rik	T	C	17: 33,065,289	I846M	probably benign	Het
Adnp	A	T	2: 168,183,727	F549L	possibly damaging	Het
Agl	A	G	3: 116,753,286	I1305T	probably benign	Het
Aldh8a1	T	A	10: 21,391,694	M326K	probably benign	Het
Amdhd1	A	T	10: 93,527,651	M295K	probably damaging	Het
Arhgef4	T	A	1: 34,807,110	C324S	probably damaging	Het
Car8	A	T	4: 8,238,119		probably null	Het
Cc2d1a	T	C	8: 84,140,839		probably benign	Het
Cd81	G	A	7: 143,062,505	V27M	possibly damaging	Het
Ces1b	A	T	8: 93,079,428	S62T	probably benign	Het
Cfb	A	G	17: 34,858,055	S30P	probably damaging	Het
Cmtm3	A	G	8: 104,343,911	M101V	possibly damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Ddb1	C	T	19: 10,612,916	S269L	probably benign	Het
Ddx25	G	A	9: 35,554,390	Q143*	probably null	Het
Dis3l2	T	A	1: 87,044,206		probably null	Het
Dlgap4	G	T	2: 156,745,978	E598*	probably null	Het
Dus1l	C	T	11: 120,789,436	G471D	possibly damaging	Het
Eya3	A	G	4: 132,689,786	N194S	probably benign	Het
Gm9992	A	G	17: 7,374,527	L174P	probably damaging	Het
Golgb1	G	T	16: 36,912,277	V629L	possibly damaging	Het
Hars2	G	A	18: 36,787,595	A164T	possibly damaging	Het
Hexb	T	A	13: 97,185,627	I217L	probably benign	Het
Hgh1	A	G	15: 76,369,648		probably null	Het
Hsd3b3	A	T	3: 98,742,441		probably null	Het
Ighg2c	T	A	12: 113,287,433	N321Y	unknown	Het
Il5	A	G	11: 53,720,936	T34A	probably benign	Het
Jph1	C	A	1: 17,004,283	E504*	probably null	Het
Kif2b	G	T	11: 91,575,594	T621K	probably benign	Het
Kmt2c	A	T	5: 25,351,270		probably benign	Het
Leprotl1	A	G	8: 34,138,852		probably null	Het
Lpar3	C	T	3: 146,240,593	R9C	possibly damaging	Het
Map1a	A	G	2: 121,300,533	E372G	probably damaging	Het
Map2	C	A	1: 66,380,768	T86K	probably damaging	Het
Map7	A	G	10: 20,273,883		probably null	Het
Mdn1	T	C	4: 32,701,713	V1482A	probably benign	Het
Mks1	G	A	11: 87,856,951		probably benign	Het
Morf4l1	T	G	9: 90,102,350	K102N	probably damaging	Het
Mroh1	T	A	15: 76,408,938	V304D	possibly damaging	Het
Mtg1	G	A	7: 140,149,752	V252M	probably damaging	Het
Myh13	A	T	11: 67,334,601	D264V	probably damaging	Het
Myh2	A	G	11: 67,186,508	Y823C	possibly damaging	Het
Myoz1	A	T	14: 20,651,184	S112R	probably benign	Het
Ncapd2	A	G	6: 125,173,482	V860A	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Npffr1	T	C	10: 61,614,231	F95L	possibly damaging	Het
Olfr585	G	T	7: 103,098,434	R231L	probably benign	Het
Olfr877	T	C	9: 37,855,196	I126T	probably damaging	Het
Orc4	A	C	2: 48,932,610		probably benign	Het
P3h3	A	C	6: 124,845,513	I565R	probably damaging	Het
Pak4	T	C	7: 28,559,777	D552G	probably benign	Het
Pcdhb4	G	T	18: 37,309,370		probably null	Het
Pdcd4	G	T	19: 53,929,094	R454L	probably damaging	Het
Pkd1l2	A	G	8: 117,044,492	I1116T	probably damaging	Het
Plcb2	A	G	2: 118,725,105		probably benign	Het
Pmpca	T	C	2: 26,393,218		probably benign	Het
Pnpla7	T	A	2: 24,997,240	I32N	probably damaging	Het
Prpf8	A	G	11: 75,493,949	K718E	probably damaging	Het
Racgap1	C	T	15: 99,626,530	A359T	probably benign	Het
Rgs3	G	A	4: 62,605,561		probably null	Het
Rhpn1	A	G	15: 75,711,654	E356G	probably damaging	Het
Rps6ka5	T	C	12: 100,574,438	H488R	possibly damaging	Het
Scn11a	A	G	9: 119,803,330		probably null	Het
Sema4f	A	T	6: 82,935,967		probably benign	Het
Serpina1f	A	G	12: 103,693,835	S63P	probably damaging	Het
Slc9a3	T	C	13: 74,159,246	W386R	probably damaging	Het
Slc9b1	A	C	3: 135,394,890	L465F	probably benign	Het
Smc5	A	G	19: 23,263,653	V165A	possibly damaging	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tinagl1	G	T	4: 130,174,023	D59E	probably damaging	Het
Tns3	A	G	11: 8,493,302	Y354H	probably damaging	Het
Trappc9	C	T	15: 72,590,107	G1103D	probably damaging	Het
Unc79	A	T	12: 102,991,428	D34V	probably damaging	Het
Unc80	T	C	1: 66,521,486	L791P	probably damaging	Het
Xpo7	G	T	14: 70,666,097		probably benign	Het
Zbtb1	T	A	12: 76,385,339	I33N	probably damaging	Het

Other mutations in Elp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00648:Elp4	APN	2	105842366	splice site	probably benign
IGL01407:Elp4	APN	2	105792308	missense	probably damaging	1.00
IGL02173:Elp4	APN	2	105702743	missense	probably damaging	0.96
IGL02370:Elp4	APN	2	105794592	missense	probably damaging	1.00
R0125:Elp4	UTSW	2	105792214	critical splice donor site	probably null
R0685:Elp4	UTSW	2	105792277	missense	possibly damaging	0.94
R1117:Elp4	UTSW	2	105842311	missense	probably benign	0.00
R1496:Elp4	UTSW	2	105832161	missense	probably benign	0.31
R1542:Elp4	UTSW	2	105794609	missense	probably benign	0.02
R1911:Elp4	UTSW	2	105702743	missense	probably damaging	0.96
R2311:Elp4	UTSW	2	105842332	missense	probably benign	0.00
R2997:Elp4	UTSW	2	105814316	missense	possibly damaging	0.82
R3079:Elp4	UTSW	2	105809445	missense	possibly damaging	0.95
R3683:Elp4	UTSW	2	105702761	missense	possibly damaging	0.75
R4747:Elp4	UTSW	2	105794607	missense	probably damaging	1.00
R4799:Elp4	UTSW	2	105809267	missense	probably damaging	0.99
R5438:Elp4	UTSW	2	105904403	missense	probably damaging	1.00
R5635:Elp4	UTSW	2	105814264	critical splice donor site	probably null
R6414:Elp4	UTSW	2	105904443	missense	possibly damaging	0.94
R7228:Elp4	UTSW	2	105792302	missense	probably damaging	1.00
R7381:Elp4	UTSW	2	105792307	missense	not run
R7560:Elp4	UTSW	2	105794588	missense	probably damaging	1.00
R7671:Elp4	UTSW	2	105904481	missense	probably damaging	0.99
R8376:Elp4	UTSW	2	105842308	missense	probably benign	0.00
R8918:Elp4	UTSW	2	105832255	missense	probably benign	0.27
R9170:Elp4	UTSW	2	105794546	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGCTGAAATATGCCACATTGAGCTG -3'
(R):5'- AGCTGTATTGAGTGCCTCCTGGTTA -3'

Sequencing Primer
(F):5'- GGACAAAAATCTGGCCTACTTTGC -3'
(R):5'- CCTGGTTATGTCAGGAGGAAAG -3'

Posted On

2013-11-08