Mutagenetix > Incidental Mutation

Incidental Mutation 'R0893:Plcb2'

83564

Institutional Source

Beutler Lab

Gene Symbol

Plcb2

Ensembl Gene

ENSMUSG00000040061

Gene Name

phospholipase C, beta 2

Synonyms

B230205M18Rik

MMRRC Submission

039056-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118707517-118728438 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 118725105 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124364 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]

AlphaFold

A3KGF7

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000006415

Predicted Effect

probably benign
Transcript: ENSMUST00000102524

SMART Domains

Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
Pfam:EF-hand_like	220	311	2.5e-24	PFAM
PLCXc	312	463	2.87e-79	SMART
low complexity region	504	518	N/A	INTRINSIC
PLCYc	547	663	2.39e-67	SMART
C2	684	783	9.17e-15	SMART
low complexity region	902	925	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
Pfam:PLC-beta_C	974	1149	4.7e-72	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159756

SMART Domains

Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
Pfam:EF-hand_like	197	288	7.1e-26	PFAM
PLCXc	289	440	2.87e-79	SMART
low complexity region	481	495	N/A	INTRINSIC
PLCYc	524	640	2.39e-67	SMART
C2	661	760	9.17e-15	SMART
low complexity region	879	902	N/A	INTRINSIC
low complexity region	906	917	N/A	INTRINSIC
Pfam:PLC-beta_C	946	1129	5.1e-68	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,219,308		probably benign	Het
4921501E09Rik	T	C	17: 33,065,289	I846M	probably benign	Het
Adnp	A	T	2: 168,183,727	F549L	possibly damaging	Het
Agl	A	G	3: 116,753,286	I1305T	probably benign	Het
Aldh8a1	T	A	10: 21,391,694	M326K	probably benign	Het
Amdhd1	A	T	10: 93,527,651	M295K	probably damaging	Het
Arhgef4	T	A	1: 34,807,110	C324S	probably damaging	Het
Car8	A	T	4: 8,238,119		probably null	Het
Cc2d1a	T	C	8: 84,140,839		probably benign	Het
Cd81	G	A	7: 143,062,505	V27M	possibly damaging	Het
Ces1b	A	T	8: 93,079,428	S62T	probably benign	Het
Cfb	A	G	17: 34,858,055	S30P	probably damaging	Het
Cmtm3	A	G	8: 104,343,911	M101V	possibly damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Ddb1	C	T	19: 10,612,916	S269L	probably benign	Het
Ddx25	G	A	9: 35,554,390	Q143*	probably null	Het
Dis3l2	T	A	1: 87,044,206		probably null	Het
Dlgap4	G	T	2: 156,745,978	E598*	probably null	Het
Dus1l	C	T	11: 120,789,436	G471D	possibly damaging	Het
Elp4	C	A	2: 105,896,945		probably benign	Het
Eya3	A	G	4: 132,689,786	N194S	probably benign	Het
Gm9992	A	G	17: 7,374,527	L174P	probably damaging	Het
Golgb1	G	T	16: 36,912,277	V629L	possibly damaging	Het
Hars2	G	A	18: 36,787,595	A164T	possibly damaging	Het
Hexb	T	A	13: 97,185,627	I217L	probably benign	Het
Hgh1	A	G	15: 76,369,648		probably null	Het
Hsd3b3	A	T	3: 98,742,441		probably null	Het
Ighg2c	T	A	12: 113,287,433	N321Y	unknown	Het
Il5	A	G	11: 53,720,936	T34A	probably benign	Het
Jph1	C	A	1: 17,004,283	E504*	probably null	Het
Kif2b	G	T	11: 91,575,594	T621K	probably benign	Het
Kmt2c	A	T	5: 25,351,270		probably benign	Het
Leprotl1	A	G	8: 34,138,852		probably null	Het
Lpar3	C	T	3: 146,240,593	R9C	possibly damaging	Het
Map1a	A	G	2: 121,300,533	E372G	probably damaging	Het
Map2	C	A	1: 66,380,768	T86K	probably damaging	Het
Map7	A	G	10: 20,273,883		probably null	Het
Mdn1	T	C	4: 32,701,713	V1482A	probably benign	Het
Mks1	G	A	11: 87,856,951		probably benign	Het
Morf4l1	T	G	9: 90,102,350	K102N	probably damaging	Het
Mroh1	T	A	15: 76,408,938	V304D	possibly damaging	Het
Mtg1	G	A	7: 140,149,752	V252M	probably damaging	Het
Myh13	A	T	11: 67,334,601	D264V	probably damaging	Het
Myh2	A	G	11: 67,186,508	Y823C	possibly damaging	Het
Myoz1	A	T	14: 20,651,184	S112R	probably benign	Het
Ncapd2	A	G	6: 125,173,482	V860A	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Npffr1	T	C	10: 61,614,231	F95L	possibly damaging	Het
Olfr585	G	T	7: 103,098,434	R231L	probably benign	Het
Olfr877	T	C	9: 37,855,196	I126T	probably damaging	Het
Orc4	A	C	2: 48,932,610		probably benign	Het
P3h3	A	C	6: 124,845,513	I565R	probably damaging	Het
Pak4	T	C	7: 28,559,777	D552G	probably benign	Het
Pcdhb4	G	T	18: 37,309,370		probably null	Het
Pdcd4	G	T	19: 53,929,094	R454L	probably damaging	Het
Pkd1l2	A	G	8: 117,044,492	I1116T	probably damaging	Het
Pmpca	T	C	2: 26,393,218		probably benign	Het
Pnpla7	T	A	2: 24,997,240	I32N	probably damaging	Het
Prpf8	A	G	11: 75,493,949	K718E	probably damaging	Het
Racgap1	C	T	15: 99,626,530	A359T	probably benign	Het
Rgs3	G	A	4: 62,605,561		probably null	Het
Rhpn1	A	G	15: 75,711,654	E356G	probably damaging	Het
Rps6ka5	T	C	12: 100,574,438	H488R	possibly damaging	Het
Scn11a	A	G	9: 119,803,330		probably null	Het
Sema4f	A	T	6: 82,935,967		probably benign	Het
Serpina1f	A	G	12: 103,693,835	S63P	probably damaging	Het
Slc9a3	T	C	13: 74,159,246	W386R	probably damaging	Het
Slc9b1	A	C	3: 135,394,890	L465F	probably benign	Het
Smc5	A	G	19: 23,263,653	V165A	possibly damaging	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tinagl1	G	T	4: 130,174,023	D59E	probably damaging	Het
Tns3	A	G	11: 8,493,302	Y354H	probably damaging	Het
Trappc9	C	T	15: 72,590,107	G1103D	probably damaging	Het
Unc79	A	T	12: 102,991,428	D34V	probably damaging	Het
Unc80	T	C	1: 66,521,486	L791P	probably damaging	Het
Xpo7	G	T	14: 70,666,097		probably benign	Het
Zbtb1	T	A	12: 76,385,339	I33N	probably damaging	Het

Other mutations in Plcb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Plcb2	APN	2	118718889	missense	probably damaging	1.00
IGL00715:Plcb2	APN	2	118713734	critical splice donor site	probably null
IGL00851:Plcb2	APN	2	118728251	missense	probably benign	0.30
IGL01765:Plcb2	APN	2	118710268	splice site	probably benign
IGL01837:Plcb2	APN	2	118711926	splice site	probably null
IGL01868:Plcb2	APN	2	118709590	missense	probably damaging	1.00
IGL01868:Plcb2	APN	2	118711387	missense	probably benign	0.09
IGL02158:Plcb2	APN	2	118711363	missense	probably benign	0.06
IGL02447:Plcb2	APN	2	118713155	missense	probably damaging	1.00
IGL02490:Plcb2	APN	2	118719760	missense	probably damaging	0.99
IGL02691:Plcb2	APN	2	118710963	missense	probably benign	0.00
IGL02723:Plcb2	APN	2	118717019	splice site	probably benign
IGL02929:Plcb2	APN	2	118713234	splice site	probably benign
IGL02949:Plcb2	APN	2	118719109	splice site	probably null
PIT4480001:Plcb2	UTSW	2	118723496	missense	probably benign	0.00
R0031:Plcb2	UTSW	2	118715461	missense	probably benign	0.36
R0157:Plcb2	UTSW	2	118718541	missense	probably damaging	0.98
R0366:Plcb2	UTSW	2	118724447	missense	probably benign	0.01
R0376:Plcb2	UTSW	2	118717240	missense	probably damaging	0.99
R0570:Plcb2	UTSW	2	118717325	missense	probably benign	0.32
R0790:Plcb2	UTSW	2	118712483	splice site	probably benign
R1647:Plcb2	UTSW	2	118723780	missense	possibly damaging	0.51
R1648:Plcb2	UTSW	2	118723780	missense	possibly damaging	0.51
R1686:Plcb2	UTSW	2	118715687	splice site	probably benign
R2210:Plcb2	UTSW	2	118717503	missense	probably damaging	1.00
R2211:Plcb2	UTSW	2	118723534	missense	probably benign	0.05
R2251:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2252:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2253:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2426:Plcb2	UTSW	2	118715649	missense	probably damaging	1.00
R3970:Plcb2	UTSW	2	118715690	splice site	probably benign
R4007:Plcb2	UTSW	2	118710793	missense	probably damaging	1.00
R4162:Plcb2	UTSW	2	118709587	missense	probably damaging	1.00
R4236:Plcb2	UTSW	2	118709566	missense	probably damaging	1.00
R4422:Plcb2	UTSW	2	118712003	missense	probably benign	0.28
R4772:Plcb2	UTSW	2	118713134	missense	probably benign	0.20
R4795:Plcb2	UTSW	2	118711124	missense	probably benign	0.32
R4935:Plcb2	UTSW	2	118718915	missense	probably damaging	1.00
R5019:Plcb2	UTSW	2	118712136	missense	probably benign	0.01
R5055:Plcb2	UTSW	2	118718222	missense	probably benign	0.06
R5452:Plcb2	UTSW	2	118718246	missense	probably damaging	0.98
R5622:Plcb2	UTSW	2	118714729	missense	probably damaging	1.00
R5752:Plcb2	UTSW	2	118711051	intron	probably benign
R6284:Plcb2	UTSW	2	118717301	missense	probably benign	0.37
R6380:Plcb2	UTSW	2	118715468	missense	probably damaging	1.00
R6574:Plcb2	UTSW	2	118719173	missense	probably damaging	0.99
R6728:Plcb2	UTSW	2	118723690	missense	probably damaging	1.00
R6792:Plcb2	UTSW	2	118719441	missense	probably damaging	1.00
R7529:Plcb2	UTSW	2	118710234	missense	probably damaging	1.00
R7560:Plcb2	UTSW	2	118715643	missense	probably damaging	0.99
R7610:Plcb2	UTSW	2	118719759	missense	possibly damaging	0.86
R7760:Plcb2	UTSW	2	118711388	missense	probably benign
R8152:Plcb2	UTSW	2	118710821	missense	probably benign	0.22
R8170:Plcb2	UTSW	2	118711453	missense	possibly damaging	0.68
R8413:Plcb2	UTSW	2	118718823	missense	probably damaging	1.00
R8913:Plcb2	UTSW	2	118713884	missense	probably damaging	1.00
R9072:Plcb2	UTSW	2	118717397	missense	possibly damaging	0.67
R9758:Plcb2	UTSW	2	118715440	missense	probably damaging	0.97
R9773:Plcb2	UTSW	2	118710793	missense	probably damaging	1.00
X0024:Plcb2	UTSW	2	118712375	missense	probably benign	0.13
Z1176:Plcb2	UTSW	2	118723128	missense	probably damaging	0.99
Z1177:Plcb2	UTSW	2	118709200	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCTATACCACCAGGGTTCTAGCG -3'
(R):5'- TCGGGGCACACTTTCCAAGATG -3'

Sequencing Primer
(F):5'- TCATTGGATCCCTTGGAGCT -3'
(R):5'- CTTTCCAAGATGGCAGCAAG -3'

Posted On

2013-11-08