Incidental Mutation 'R0893:Eya3'
Institutional Source Beutler Lab
Gene Symbol Eya3
Ensembl Gene ENSMUSG00000028886
Gene NameEYA transcriptional coactivator and phosphatase 3
MMRRC Submission 039056-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R0893 (G1)
Quality Score189
Status Validated
Chromosomal Location132638987-132724765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132689786 bp
Amino Acid Change Asparagine to Serine at position 194 (N194S)
Ref Sequence ENSEMBL: ENSMUSP00000123045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020197] [ENSMUST00000079157] [ENSMUST00000081726] [ENSMUST00000135299] [ENSMUST00000180250]
Predicted Effect probably benign
Transcript: ENSMUST00000020197
AA Change: N38S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020197
Gene: ENSMUSG00000028886
AA Change: N38S

low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000079157
AA Change: N132S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078157
Gene: ENSMUSG00000028886
AA Change: N132S

low complexity region 72 89 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
PDB:4EGC|B 226 510 1e-135 PDB
SCOP:d1lvha_ 345 507 8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081726
AA Change: N148S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080425
Gene: ENSMUSG00000028886
AA Change: N148S

low complexity region 88 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
Pfam:Hydrolase 256 502 5.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134868
Predicted Effect probably benign
Transcript: ENSMUST00000135299
AA Change: N194S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123045
Gene: ENSMUSG00000028886
AA Change: N194S

low complexity region 88 105 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
low complexity region 227 239 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157029
Predicted Effect probably benign
Transcript: ENSMUST00000180250
AA Change: N38S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136812
Gene: ENSMUSG00000028886
AA Change: N38S

low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator and have a role during development. It can act as a mediator of chemoresistance and cell survival in Ewing sarcoma cells, where this gene is up-regulated via a micro-RNA that binds to the 3' UTR of the transcript. A similar protein in mice acts as a transcriptional activator. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal heart function, decreased grip strength and increased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,219,308 probably benign Het
4921501E09Rik T C 17: 33,065,289 I846M probably benign Het
Adnp A T 2: 168,183,727 F549L possibly damaging Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Aldh8a1 T A 10: 21,391,694 M326K probably benign Het
Amdhd1 A T 10: 93,527,651 M295K probably damaging Het
Arhgef4 T A 1: 34,807,110 C324S probably damaging Het
Car8 A T 4: 8,238,119 probably null Het
Cc2d1a T C 8: 84,140,839 probably benign Het
Cd81 G A 7: 143,062,505 V27M possibly damaging Het
Ces1b A T 8: 93,079,428 S62T probably benign Het
Cfb A G 17: 34,858,055 S30P probably damaging Het
Cmtm3 A G 8: 104,343,911 M101V possibly damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Ddb1 C T 19: 10,612,916 S269L probably benign Het
Ddx25 G A 9: 35,554,390 Q143* probably null Het
Dis3l2 T A 1: 87,044,206 probably null Het
Dlgap4 G T 2: 156,745,978 E598* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Elp4 C A 2: 105,896,945 probably benign Het
Gm9992 A G 17: 7,374,527 L174P probably damaging Het
Golgb1 G T 16: 36,912,277 V629L possibly damaging Het
Hars2 G A 18: 36,787,595 A164T possibly damaging Het
Hexb T A 13: 97,185,627 I217L probably benign Het
Hgh1 A G 15: 76,369,648 probably null Het
Hsd3b3 A T 3: 98,742,441 probably null Het
Ighg2c T A 12: 113,287,433 N321Y unknown Het
Il5 A G 11: 53,720,936 T34A probably benign Het
Jph1 C A 1: 17,004,283 E504* probably null Het
Kif2b G T 11: 91,575,594 T621K probably benign Het
Kmt2c A T 5: 25,351,270 probably benign Het
Leprotl1 A G 8: 34,138,852 probably null Het
Lpar3 C T 3: 146,240,593 R9C possibly damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Map2 C A 1: 66,380,768 T86K probably damaging Het
Map7 A G 10: 20,273,883 probably null Het
Mdn1 T C 4: 32,701,713 V1482A probably benign Het
Mks1 G A 11: 87,856,951 probably benign Het
Morf4l1 T G 9: 90,102,350 K102N probably damaging Het
Mroh1 T A 15: 76,408,938 V304D possibly damaging Het
Mtg1 G A 7: 140,149,752 V252M probably damaging Het
Myh13 A T 11: 67,334,601 D264V probably damaging Het
Myh2 A G 11: 67,186,508 Y823C possibly damaging Het
Myoz1 A T 14: 20,651,184 S112R probably benign Het
Ncapd2 A G 6: 125,173,482 V860A probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Npffr1 T C 10: 61,614,231 F95L possibly damaging Het
Olfr585 G T 7: 103,098,434 R231L probably benign Het
Olfr877 T C 9: 37,855,196 I126T probably damaging Het
Orc4 A C 2: 48,932,610 probably benign Het
P3h3 A C 6: 124,845,513 I565R probably damaging Het
Pak4 T C 7: 28,559,777 D552G probably benign Het
Pcdhb4 G T 18: 37,309,370 probably null Het
Pdcd4 G T 19: 53,929,094 R454L probably damaging Het
Pkd1l2 A G 8: 117,044,492 I1116T probably damaging Het
Plcb2 A G 2: 118,725,105 probably benign Het
Pmpca T C 2: 26,393,218 probably benign Het
Pnpla7 T A 2: 24,997,240 I32N probably damaging Het
Prpf8 A G 11: 75,493,949 K718E probably damaging Het
Racgap1 C T 15: 99,626,530 A359T probably benign Het
Rgs3 G A 4: 62,605,561 probably null Het
Rhpn1 A G 15: 75,711,654 E356G probably damaging Het
Rps6ka5 T C 12: 100,574,438 H488R possibly damaging Het
Scn11a A G 9: 119,803,330 probably null Het
Sema4f A T 6: 82,935,967 probably benign Het
Serpina1f A G 12: 103,693,835 S63P probably damaging Het
Slc9a3 T C 13: 74,159,246 W386R probably damaging Het
Slc9b1 A C 3: 135,394,890 L465F probably benign Het
Smc5 A G 19: 23,263,653 V165A possibly damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tinagl1 G T 4: 130,174,023 D59E probably damaging Het
Tns3 A G 11: 8,493,302 Y354H probably damaging Het
Trappc9 C T 15: 72,590,107 G1103D probably damaging Het
Unc79 A T 12: 102,991,428 D34V probably damaging Het
Unc80 T C 1: 66,521,486 L791P probably damaging Het
Xpo7 G T 14: 70,666,097 probably benign Het
Zbtb1 T A 12: 76,385,339 I33N probably damaging Het
Other mutations in Eya3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Eya3 APN 4 132704398 missense probably damaging 1.00
IGL01104:Eya3 APN 4 132711929 missense probably damaging 1.00
IGL01109:Eya3 APN 4 132693000 nonsense probably null
IGL01145:Eya3 APN 4 132709995 missense probably damaging 1.00
IGL02364:Eya3 APN 4 132710055 missense probably damaging 1.00
IGL03008:Eya3 APN 4 132706983 missense probably damaging 1.00
IGL03144:Eya3 APN 4 132693142 missense probably benign 0.07
IGL03176:Eya3 APN 4 132711922 missense possibly damaging 0.90
R0279:Eya3 UTSW 4 132719247 missense probably damaging 1.00
R0621:Eya3 UTSW 4 132694802 missense probably benign 0.00
R1416:Eya3 UTSW 4 132707129 splice site probably benign
R1834:Eya3 UTSW 4 132707118 missense probably damaging 0.99
R1903:Eya3 UTSW 4 132721352 unclassified probably null
R4696:Eya3 UTSW 4 132670232 nonsense probably null
R4739:Eya3 UTSW 4 132721387 utr 3 prime probably benign
R4758:Eya3 UTSW 4 132694885 critical splice donor site probably null
R5061:Eya3 UTSW 4 132704378 missense probably damaging 1.00
R5411:Eya3 UTSW 4 132689779 missense probably damaging 0.99
R5479:Eya3 UTSW 4 132672933 missense possibly damaging 0.91
R6117:Eya3 UTSW 4 132711862 missense probably damaging 1.00
R6343:Eya3 UTSW 4 132672910 missense probably damaging 0.96
R6443:Eya3 UTSW 4 132711927 missense probably damaging 1.00
R6460:Eya3 UTSW 4 132680863 missense probably damaging 0.97
R7116:Eya3 UTSW 4 132694799 missense probably benign 0.00
R7418:Eya3 UTSW 4 132680848 missense possibly damaging 0.92
R7594:Eya3 UTSW 4 132694825 missense probably benign
R7624:Eya3 UTSW 4 132672951 missense probably benign 0.41
R7811:Eya3 UTSW 4 132711961 missense possibly damaging 0.64
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aacaactgagccatctctcc -3'
Posted On2013-11-08