Incidental Mutation 'R0893:Pkd1l2'
ID 83591
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Name polycystic kidney disease 1 like 2
Synonyms 1700126L06Rik
MMRRC Submission 039056-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0893 (G1)
Quality Score 201
Status Validated
Chromosome 8
Chromosomal Location 117722418-117809188 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117771231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1116 (I1116T)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098375
AA Change: I1115T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: I1115T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109093
AA Change: I1116T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: I1116T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153724
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,266,082 (GRCm39) probably benign Het
Adnp A T 2: 168,025,647 (GRCm39) F549L possibly damaging Het
Agl A G 3: 116,546,935 (GRCm39) I1305T probably benign Het
Aldh8a1 T A 10: 21,267,593 (GRCm39) M326K probably benign Het
Amdhd1 A T 10: 93,363,513 (GRCm39) M295K probably damaging Het
Arhgef4 T A 1: 34,846,191 (GRCm39) C324S probably damaging Het
Car8 A T 4: 8,238,119 (GRCm39) probably null Het
Cc2d1a T C 8: 84,867,468 (GRCm39) probably benign Het
Cd81 G A 7: 142,616,242 (GRCm39) V27M possibly damaging Het
Ces1b A T 8: 93,806,056 (GRCm39) S62T probably benign Het
Cfb A G 17: 35,077,031 (GRCm39) S30P probably damaging Het
Cmtm3 A G 8: 105,070,543 (GRCm39) M101V possibly damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Ddb1 C T 19: 10,590,280 (GRCm39) S269L probably benign Het
Ddx25 G A 9: 35,465,686 (GRCm39) Q143* probably null Het
Dis3l2 T A 1: 86,971,928 (GRCm39) probably null Het
Dlgap4 G T 2: 156,587,898 (GRCm39) E598* probably null Het
Dus1l C T 11: 120,680,262 (GRCm39) G471D possibly damaging Het
Elp4 C A 2: 105,727,290 (GRCm39) probably benign Het
Eya3 A G 4: 132,417,097 (GRCm39) N194S probably benign Het
Golgb1 G T 16: 36,732,639 (GRCm39) V629L possibly damaging Het
Hars2 G A 18: 36,920,648 (GRCm39) A164T possibly damaging Het
Hexb T A 13: 97,322,135 (GRCm39) I217L probably benign Het
Hgh1 A G 15: 76,253,848 (GRCm39) probably null Het
Hsd3b3 A T 3: 98,649,757 (GRCm39) probably null Het
Ighg2c T A 12: 113,251,053 (GRCm39) N321Y unknown Het
Il5 A G 11: 53,611,763 (GRCm39) T34A probably benign Het
Jph1 C A 1: 17,074,507 (GRCm39) E504* probably null Het
Kif2b G T 11: 91,466,420 (GRCm39) T621K probably benign Het
Kmt2c A T 5: 25,556,268 (GRCm39) probably benign Het
Leprotl1 A G 8: 34,606,006 (GRCm39) probably null Het
Lpar3 C T 3: 145,946,348 (GRCm39) R9C possibly damaging Het
Map1a A G 2: 121,131,014 (GRCm39) E372G probably damaging Het
Map2 C A 1: 66,419,927 (GRCm39) T86K probably damaging Het
Map7 A G 10: 20,149,629 (GRCm39) probably null Het
Mdn1 T C 4: 32,701,713 (GRCm39) V1482A probably benign Het
Mks1 G A 11: 87,747,777 (GRCm39) probably benign Het
Morf4l1 T G 9: 89,984,403 (GRCm39) K102N probably damaging Het
Mroh1 T A 15: 76,293,138 (GRCm39) V304D possibly damaging Het
Mtg1 G A 7: 139,729,665 (GRCm39) V252M probably damaging Het
Myh13 A T 11: 67,225,427 (GRCm39) D264V probably damaging Het
Myh2 A G 11: 67,077,334 (GRCm39) Y823C possibly damaging Het
Myoz1 A T 14: 20,701,252 (GRCm39) S112R probably benign Het
Ncapd2 A G 6: 125,150,445 (GRCm39) V860A probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Npffr1 T C 10: 61,450,010 (GRCm39) F95L possibly damaging Het
Or51f1e G T 7: 102,747,641 (GRCm39) R231L probably benign Het
Or8b9 T C 9: 37,766,492 (GRCm39) I126T probably damaging Het
Orc4 A C 2: 48,822,622 (GRCm39) probably benign Het
P3h3 A C 6: 124,822,476 (GRCm39) I565R probably damaging Het
Pak4 T C 7: 28,259,202 (GRCm39) D552G probably benign Het
Pcdhb4 G T 18: 37,442,423 (GRCm39) probably null Het
Pdcd4 G T 19: 53,917,525 (GRCm39) R454L probably damaging Het
Phf8-ps T C 17: 33,284,263 (GRCm39) I846M probably benign Het
Plcb2 A G 2: 118,555,586 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,230 (GRCm39) probably benign Het
Pnpla7 T A 2: 24,887,252 (GRCm39) I32N probably damaging Het
Prpf8 A G 11: 75,384,775 (GRCm39) K718E probably damaging Het
Racgap1 C T 15: 99,524,411 (GRCm39) A359T probably benign Het
Rgs3 G A 4: 62,523,798 (GRCm39) probably null Het
Rhpn1 A G 15: 75,583,503 (GRCm39) E356G probably damaging Het
Rps6ka5 T C 12: 100,540,697 (GRCm39) H488R possibly damaging Het
Scn11a A G 9: 119,632,396 (GRCm39) probably null Het
Sema4f A T 6: 82,912,948 (GRCm39) probably benign Het
Serpina1f A G 12: 103,660,094 (GRCm39) S63P probably damaging Het
Slc9a3 T C 13: 74,307,365 (GRCm39) W386R probably damaging Het
Slc9b1 A C 3: 135,100,651 (GRCm39) L465F probably benign Het
Smc5 A G 19: 23,241,017 (GRCm39) V165A possibly damaging Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tinagl1 G T 4: 130,067,816 (GRCm39) D59E probably damaging Het
Tns3 A G 11: 8,443,302 (GRCm39) Y354H probably damaging Het
Trappc9 C T 15: 72,461,956 (GRCm39) G1103D probably damaging Het
Unc79 A T 12: 102,957,687 (GRCm39) D34V probably damaging Het
Unc80 T C 1: 66,560,645 (GRCm39) L791P probably damaging Het
Unc93a2 A G 17: 7,641,926 (GRCm39) L174P probably damaging Het
Xpo7 G T 14: 70,903,537 (GRCm39) probably benign Het
Zbtb1 T A 12: 76,432,113 (GRCm39) I33N probably damaging Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117,786,259 (GRCm39) nonsense probably null
IGL01353:Pkd1l2 APN 8 117,784,182 (GRCm39) missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117,748,595 (GRCm39) missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117,786,331 (GRCm39) missense probably benign
IGL01672:Pkd1l2 APN 8 117,807,471 (GRCm39) missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117,783,126 (GRCm39) missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 117,724,913 (GRCm39) missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117,787,264 (GRCm39) missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117,743,655 (GRCm39) missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117,736,303 (GRCm39) splice site probably benign
IGL02381:Pkd1l2 APN 8 117,762,539 (GRCm39) splice site probably benign
IGL02416:Pkd1l2 APN 8 117,767,574 (GRCm39) missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117,767,405 (GRCm39) missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117,756,298 (GRCm39) missense probably benign
IGL02861:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117,740,630 (GRCm39) missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117,750,830 (GRCm39) missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 117,722,548 (GRCm39) missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117,792,484 (GRCm39) missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117,748,761 (GRCm39) missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117,776,787 (GRCm39) splice site probably benign
R0309:Pkd1l2 UTSW 8 117,724,315 (GRCm39) missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117,748,589 (GRCm39) missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117,808,999 (GRCm39) missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117,808,957 (GRCm39) missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117,777,839 (GRCm39) missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117,802,916 (GRCm39) missense possibly damaging 0.90
R1256:Pkd1l2 UTSW 8 117,746,282 (GRCm39) critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117,781,673 (GRCm39) missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117,792,236 (GRCm39) splice site probably benign
R1491:Pkd1l2 UTSW 8 117,755,147 (GRCm39) missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117,772,898 (GRCm39) missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117,792,239 (GRCm39) splice site probably null
R1544:Pkd1l2 UTSW 8 117,764,974 (GRCm39) frame shift probably null
R1558:Pkd1l2 UTSW 8 117,808,991 (GRCm39) missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117,767,514 (GRCm39) missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117,783,158 (GRCm39) missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117,757,458 (GRCm39) missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117,767,408 (GRCm39) missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117,772,921 (GRCm39) nonsense probably null
R1955:Pkd1l2 UTSW 8 117,770,100 (GRCm39) missense probably benign
R1957:Pkd1l2 UTSW 8 117,757,421 (GRCm39) missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117,769,970 (GRCm39) critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117,746,272 (GRCm39) missense probably benign
R2046:Pkd1l2 UTSW 8 117,726,694 (GRCm39) missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117,808,208 (GRCm39) missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117,757,461 (GRCm39) missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117,783,064 (GRCm39) missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117,784,177 (GRCm39) missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117,784,177 (GRCm39) missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117,770,056 (GRCm39) missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117,746,233 (GRCm39) missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117,764,903 (GRCm39) missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117,764,903 (GRCm39) missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117,792,290 (GRCm39) missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117,795,054 (GRCm39) critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117,767,478 (GRCm39) missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 117,722,581 (GRCm39) critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 117,722,581 (GRCm39) critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117,746,168 (GRCm39) missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117,738,314 (GRCm39) missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117,781,624 (GRCm39) missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117,799,288 (GRCm39) missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117,774,113 (GRCm39) splice site probably null
R5057:Pkd1l2 UTSW 8 117,781,747 (GRCm39) missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117,783,181 (GRCm39) missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117,761,857 (GRCm39) missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117,757,388 (GRCm39) missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117,792,569 (GRCm39) missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117,794,855 (GRCm39) missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117,767,522 (GRCm39) nonsense probably null
R5610:Pkd1l2 UTSW 8 117,769,059 (GRCm39) missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117,781,757 (GRCm39) missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117,792,485 (GRCm39) missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117,781,750 (GRCm39) missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 117,724,321 (GRCm39) missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117,756,387 (GRCm39) missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117,750,795 (GRCm39) missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117,769,976 (GRCm39) missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117,769,976 (GRCm39) missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117,740,726 (GRCm39) missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117,809,107 (GRCm39) missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117,808,209 (GRCm39) missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117,762,586 (GRCm39) missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117,740,638 (GRCm39) missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117,740,638 (GRCm39) missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117,767,405 (GRCm39) missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117,757,370 (GRCm39) missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117,740,681 (GRCm39) missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117,802,870 (GRCm39) nonsense probably null
R7148:Pkd1l2 UTSW 8 117,807,525 (GRCm39) missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117,767,574 (GRCm39) missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 117,722,536 (GRCm39) missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117,750,773 (GRCm39) missense probably benign
R7382:Pkd1l2 UTSW 8 117,781,610 (GRCm39) missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117,762,641 (GRCm39) missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117,755,218 (GRCm39) missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117,757,421 (GRCm39) missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117,794,849 (GRCm39) missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117,787,333 (GRCm39) missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117,792,268 (GRCm39) missense probably benign
R7590:Pkd1l2 UTSW 8 117,807,525 (GRCm39) missense probably benign 0.00
R7623:Pkd1l2 UTSW 8 117,756,384 (GRCm39) missense probably damaging 1.00
R7768:Pkd1l2 UTSW 8 117,781,599 (GRCm39) critical splice donor site probably null
R7897:Pkd1l2 UTSW 8 117,724,827 (GRCm39) missense possibly damaging 0.69
R7982:Pkd1l2 UTSW 8 117,777,926 (GRCm39) missense possibly damaging 0.70
R8024:Pkd1l2 UTSW 8 117,802,921 (GRCm39) missense possibly damaging 0.85
R8140:Pkd1l2 UTSW 8 117,774,236 (GRCm39) missense probably benign
R8145:Pkd1l2 UTSW 8 117,781,742 (GRCm39) missense probably benign
R8228:Pkd1l2 UTSW 8 117,792,514 (GRCm39) missense probably damaging 0.97
R8252:Pkd1l2 UTSW 8 117,767,472 (GRCm39) missense probably benign 0.29
R8500:Pkd1l2 UTSW 8 117,774,302 (GRCm39) critical splice acceptor site probably null
R8732:Pkd1l2 UTSW 8 117,792,311 (GRCm39) missense probably benign 0.28
R8809:Pkd1l2 UTSW 8 117,726,660 (GRCm39) missense probably damaging 1.00
R8896:Pkd1l2 UTSW 8 117,740,615 (GRCm39) missense possibly damaging 0.91
R8961:Pkd1l2 UTSW 8 117,726,717 (GRCm39) missense possibly damaging 0.52
R8985:Pkd1l2 UTSW 8 117,764,849 (GRCm39) missense probably benign 0.01
R9008:Pkd1l2 UTSW 8 117,769,037 (GRCm39) missense probably benign 0.32
R9091:Pkd1l2 UTSW 8 117,759,433 (GRCm39) missense probably damaging 1.00
R9138:Pkd1l2 UTSW 8 117,781,748 (GRCm39) missense probably benign 0.43
R9160:Pkd1l2 UTSW 8 117,767,408 (GRCm39) missense possibly damaging 0.70
R9249:Pkd1l2 UTSW 8 117,746,159 (GRCm39) missense probably damaging 0.99
R9270:Pkd1l2 UTSW 8 117,759,433 (GRCm39) missense probably damaging 1.00
R9735:Pkd1l2 UTSW 8 117,772,820 (GRCm39) missense possibly damaging 0.94
Z1176:Pkd1l2 UTSW 8 117,781,653 (GRCm39) missense probably damaging 1.00
Z1177:Pkd1l2 UTSW 8 117,757,430 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTCATGAAGCCAAGGCTGC -3'
(R):5'- TGGACCTCTGATACACACCTGGAC -3'

Sequencing Primer
(F):5'- GCACTTGCAACCTGCTAGAAATAG -3'
(R):5'- AATGGGGGTTCTTCCTCAAACAC -3'
Posted On 2013-11-08