Incidental Mutation 'R0893:Scn11a'
ID83595
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 039056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0893 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 119803330 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably null
Transcript: ENSMUST00000070617
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215718
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,219,308 probably benign Het
4921501E09Rik T C 17: 33,065,289 I846M probably benign Het
Adnp A T 2: 168,183,727 F549L possibly damaging Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Aldh8a1 T A 10: 21,391,694 M326K probably benign Het
Amdhd1 A T 10: 93,527,651 M295K probably damaging Het
Arhgef4 T A 1: 34,807,110 C324S probably damaging Het
Car8 A T 4: 8,238,119 probably null Het
Cc2d1a T C 8: 84,140,839 probably benign Het
Cd81 G A 7: 143,062,505 V27M possibly damaging Het
Ces1b A T 8: 93,079,428 S62T probably benign Het
Cfb A G 17: 34,858,055 S30P probably damaging Het
Cmtm3 A G 8: 104,343,911 M101V possibly damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Ddb1 C T 19: 10,612,916 S269L probably benign Het
Ddx25 G A 9: 35,554,390 Q143* probably null Het
Dis3l2 T A 1: 87,044,206 probably null Het
Dlgap4 G T 2: 156,745,978 E598* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Elp4 C A 2: 105,896,945 probably benign Het
Eya3 A G 4: 132,689,786 N194S probably benign Het
Gm9992 A G 17: 7,374,527 L174P probably damaging Het
Golgb1 G T 16: 36,912,277 V629L possibly damaging Het
Hars2 G A 18: 36,787,595 A164T possibly damaging Het
Hexb T A 13: 97,185,627 I217L probably benign Het
Hgh1 A G 15: 76,369,648 probably null Het
Hsd3b3 A T 3: 98,742,441 probably null Het
Ighg2c T A 12: 113,287,433 N321Y unknown Het
Il5 A G 11: 53,720,936 T34A probably benign Het
Jph1 C A 1: 17,004,283 E504* probably null Het
Kif2b G T 11: 91,575,594 T621K probably benign Het
Kmt2c A T 5: 25,351,270 probably benign Het
Leprotl1 A G 8: 34,138,852 probably null Het
Lpar3 C T 3: 146,240,593 R9C possibly damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Map2 C A 1: 66,380,768 T86K probably damaging Het
Map7 A G 10: 20,273,883 probably null Het
Mdn1 T C 4: 32,701,713 V1482A probably benign Het
Mks1 G A 11: 87,856,951 probably benign Het
Morf4l1 T G 9: 90,102,350 K102N probably damaging Het
Mroh1 T A 15: 76,408,938 V304D possibly damaging Het
Mtg1 G A 7: 140,149,752 V252M probably damaging Het
Myh13 A T 11: 67,334,601 D264V probably damaging Het
Myh2 A G 11: 67,186,508 Y823C possibly damaging Het
Myoz1 A T 14: 20,651,184 S112R probably benign Het
Ncapd2 A G 6: 125,173,482 V860A probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Npffr1 T C 10: 61,614,231 F95L possibly damaging Het
Olfr585 G T 7: 103,098,434 R231L probably benign Het
Olfr877 T C 9: 37,855,196 I126T probably damaging Het
Orc4 A C 2: 48,932,610 probably benign Het
P3h3 A C 6: 124,845,513 I565R probably damaging Het
Pak4 T C 7: 28,559,777 D552G probably benign Het
Pcdhb4 G T 18: 37,309,370 probably null Het
Pdcd4 G T 19: 53,929,094 R454L probably damaging Het
Pkd1l2 A G 8: 117,044,492 I1116T probably damaging Het
Plcb2 A G 2: 118,725,105 probably benign Het
Pmpca T C 2: 26,393,218 probably benign Het
Pnpla7 T A 2: 24,997,240 I32N probably damaging Het
Prpf8 A G 11: 75,493,949 K718E probably damaging Het
Racgap1 C T 15: 99,626,530 A359T probably benign Het
Rgs3 G A 4: 62,605,561 probably null Het
Rhpn1 A G 15: 75,711,654 E356G probably damaging Het
Rps6ka5 T C 12: 100,574,438 H488R possibly damaging Het
Sema4f A T 6: 82,935,967 probably benign Het
Serpina1f A G 12: 103,693,835 S63P probably damaging Het
Slc9a3 T C 13: 74,159,246 W386R probably damaging Het
Slc9b1 A C 3: 135,394,890 L465F probably benign Het
Smc5 A G 19: 23,263,653 V165A possibly damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tinagl1 G T 4: 130,174,023 D59E probably damaging Het
Tns3 A G 11: 8,493,302 Y354H probably damaging Het
Trappc9 C T 15: 72,590,107 G1103D probably damaging Het
Unc79 A T 12: 102,991,428 D34V probably damaging Het
Unc80 T C 1: 66,521,486 L791P probably damaging Het
Xpo7 G T 14: 70,666,097 probably benign Het
Zbtb1 T A 12: 76,385,339 I33N probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACACGCACACTGTGACTGAC -3'
(R):5'- TGACAGAGACAGCAGAGTAGCTCC -3'

Sequencing Primer
(F):5'- TGTGACTGACTGCTCACACATATAC -3'
(R):5'- GCGTTTTCACAGGGAGCTATAATC -3'
Posted On2013-11-08