Incidental Mutation 'R0893:Scn11a'
ID 83595
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 039056-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R0893 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to G at 119632396 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably null
Transcript: ENSMUST00000070617
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215718
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,266,082 (GRCm39) probably benign Het
Adnp A T 2: 168,025,647 (GRCm39) F549L possibly damaging Het
Agl A G 3: 116,546,935 (GRCm39) I1305T probably benign Het
Aldh8a1 T A 10: 21,267,593 (GRCm39) M326K probably benign Het
Amdhd1 A T 10: 93,363,513 (GRCm39) M295K probably damaging Het
Arhgef4 T A 1: 34,846,191 (GRCm39) C324S probably damaging Het
Car8 A T 4: 8,238,119 (GRCm39) probably null Het
Cc2d1a T C 8: 84,867,468 (GRCm39) probably benign Het
Cd81 G A 7: 142,616,242 (GRCm39) V27M possibly damaging Het
Ces1b A T 8: 93,806,056 (GRCm39) S62T probably benign Het
Cfb A G 17: 35,077,031 (GRCm39) S30P probably damaging Het
Cmtm3 A G 8: 105,070,543 (GRCm39) M101V possibly damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Ddb1 C T 19: 10,590,280 (GRCm39) S269L probably benign Het
Ddx25 G A 9: 35,465,686 (GRCm39) Q143* probably null Het
Dis3l2 T A 1: 86,971,928 (GRCm39) probably null Het
Dlgap4 G T 2: 156,587,898 (GRCm39) E598* probably null Het
Dus1l C T 11: 120,680,262 (GRCm39) G471D possibly damaging Het
Elp4 C A 2: 105,727,290 (GRCm39) probably benign Het
Eya3 A G 4: 132,417,097 (GRCm39) N194S probably benign Het
Golgb1 G T 16: 36,732,639 (GRCm39) V629L possibly damaging Het
Hars2 G A 18: 36,920,648 (GRCm39) A164T possibly damaging Het
Hexb T A 13: 97,322,135 (GRCm39) I217L probably benign Het
Hgh1 A G 15: 76,253,848 (GRCm39) probably null Het
Hsd3b3 A T 3: 98,649,757 (GRCm39) probably null Het
Ighg2c T A 12: 113,251,053 (GRCm39) N321Y unknown Het
Il5 A G 11: 53,611,763 (GRCm39) T34A probably benign Het
Jph1 C A 1: 17,074,507 (GRCm39) E504* probably null Het
Kif2b G T 11: 91,466,420 (GRCm39) T621K probably benign Het
Kmt2c A T 5: 25,556,268 (GRCm39) probably benign Het
Leprotl1 A G 8: 34,606,006 (GRCm39) probably null Het
Lpar3 C T 3: 145,946,348 (GRCm39) R9C possibly damaging Het
Map1a A G 2: 121,131,014 (GRCm39) E372G probably damaging Het
Map2 C A 1: 66,419,927 (GRCm39) T86K probably damaging Het
Map7 A G 10: 20,149,629 (GRCm39) probably null Het
Mdn1 T C 4: 32,701,713 (GRCm39) V1482A probably benign Het
Mks1 G A 11: 87,747,777 (GRCm39) probably benign Het
Morf4l1 T G 9: 89,984,403 (GRCm39) K102N probably damaging Het
Mroh1 T A 15: 76,293,138 (GRCm39) V304D possibly damaging Het
Mtg1 G A 7: 139,729,665 (GRCm39) V252M probably damaging Het
Myh13 A T 11: 67,225,427 (GRCm39) D264V probably damaging Het
Myh2 A G 11: 67,077,334 (GRCm39) Y823C possibly damaging Het
Myoz1 A T 14: 20,701,252 (GRCm39) S112R probably benign Het
Ncapd2 A G 6: 125,150,445 (GRCm39) V860A probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Npffr1 T C 10: 61,450,010 (GRCm39) F95L possibly damaging Het
Or51f1e G T 7: 102,747,641 (GRCm39) R231L probably benign Het
Or8b9 T C 9: 37,766,492 (GRCm39) I126T probably damaging Het
Orc4 A C 2: 48,822,622 (GRCm39) probably benign Het
P3h3 A C 6: 124,822,476 (GRCm39) I565R probably damaging Het
Pak4 T C 7: 28,259,202 (GRCm39) D552G probably benign Het
Pcdhb4 G T 18: 37,442,423 (GRCm39) probably null Het
Pdcd4 G T 19: 53,917,525 (GRCm39) R454L probably damaging Het
Phf8-ps T C 17: 33,284,263 (GRCm39) I846M probably benign Het
Pkd1l2 A G 8: 117,771,231 (GRCm39) I1116T probably damaging Het
Plcb2 A G 2: 118,555,586 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,230 (GRCm39) probably benign Het
Pnpla7 T A 2: 24,887,252 (GRCm39) I32N probably damaging Het
Prpf8 A G 11: 75,384,775 (GRCm39) K718E probably damaging Het
Racgap1 C T 15: 99,524,411 (GRCm39) A359T probably benign Het
Rgs3 G A 4: 62,523,798 (GRCm39) probably null Het
Rhpn1 A G 15: 75,583,503 (GRCm39) E356G probably damaging Het
Rps6ka5 T C 12: 100,540,697 (GRCm39) H488R possibly damaging Het
Sema4f A T 6: 82,912,948 (GRCm39) probably benign Het
Serpina1f A G 12: 103,660,094 (GRCm39) S63P probably damaging Het
Slc9a3 T C 13: 74,307,365 (GRCm39) W386R probably damaging Het
Slc9b1 A C 3: 135,100,651 (GRCm39) L465F probably benign Het
Smc5 A G 19: 23,241,017 (GRCm39) V165A possibly damaging Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tinagl1 G T 4: 130,067,816 (GRCm39) D59E probably damaging Het
Tns3 A G 11: 8,443,302 (GRCm39) Y354H probably damaging Het
Trappc9 C T 15: 72,461,956 (GRCm39) G1103D probably damaging Het
Unc79 A T 12: 102,957,687 (GRCm39) D34V probably damaging Het
Unc80 T C 1: 66,560,645 (GRCm39) L791P probably damaging Het
Unc93a2 A G 17: 7,641,926 (GRCm39) L174P probably damaging Het
Xpo7 G T 14: 70,903,537 (GRCm39) probably benign Het
Zbtb1 T A 12: 76,432,113 (GRCm39) I33N probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCACACGCACACTGTGACTGAC -3'
(R):5'- TGACAGAGACAGCAGAGTAGCTCC -3'

Sequencing Primer
(F):5'- TGTGACTGACTGCTCACACATATAC -3'
(R):5'- GCGTTTTCACAGGGAGCTATAATC -3'
Posted On 2013-11-08