Mutagenetix > Incidental Mutations

Incidental Mutation 'R0893:Slc9a3'

83614

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

MMRRC Submission

039056-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74159246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 386 (W386R)

Ref Sequence

ENSEMBL: ENSMUSP00000152682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]

AlphaFold

G3X939

Predicted Effect

probably damaging
Transcript: ENSMUST00000036208
AA Change: W386R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: W386R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000221703
AA Change: W386R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225423
AA Change: W386R

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.8199

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,219,308		probably benign	Het
4921501E09Rik	T	C	17: 33,065,289	I846M	probably benign	Het
Adnp	A	T	2: 168,183,727	F549L	possibly damaging	Het
Agl	A	G	3: 116,753,286	I1305T	probably benign	Het
Aldh8a1	T	A	10: 21,391,694	M326K	probably benign	Het
Amdhd1	A	T	10: 93,527,651	M295K	probably damaging	Het
Arhgef4	T	A	1: 34,807,110	C324S	probably damaging	Het
Car8	A	T	4: 8,238,119		probably null	Het
Cc2d1a	T	C	8: 84,140,839		probably benign	Het
Cd81	G	A	7: 143,062,505	V27M	possibly damaging	Het
Ces1b	A	T	8: 93,079,428	S62T	probably benign	Het
Cfb	A	G	17: 34,858,055	S30P	probably damaging	Het
Cmtm3	A	G	8: 104,343,911	M101V	possibly damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Ddb1	C	T	19: 10,612,916	S269L	probably benign	Het
Ddx25	G	A	9: 35,554,390	Q143*	probably null	Het
Dis3l2	T	A	1: 87,044,206		probably null	Het
Dlgap4	G	T	2: 156,745,978	E598*	probably null	Het
Dus1l	C	T	11: 120,789,436	G471D	possibly damaging	Het
Elp4	C	A	2: 105,896,945		probably benign	Het
Eya3	A	G	4: 132,689,786	N194S	probably benign	Het
Gm9992	A	G	17: 7,374,527	L174P	probably damaging	Het
Golgb1	G	T	16: 36,912,277	V629L	possibly damaging	Het
Hars2	G	A	18: 36,787,595	A164T	possibly damaging	Het
Hexb	T	A	13: 97,185,627	I217L	probably benign	Het
Hgh1	A	G	15: 76,369,648		probably null	Het
Hsd3b3	A	T	3: 98,742,441		probably null	Het
Ighg2c	T	A	12: 113,287,433	N321Y	unknown	Het
Il5	A	G	11: 53,720,936	T34A	probably benign	Het
Jph1	C	A	1: 17,004,283	E504*	probably null	Het
Kif2b	G	T	11: 91,575,594	T621K	probably benign	Het
Kmt2c	A	T	5: 25,351,270		probably benign	Het
Leprotl1	A	G	8: 34,138,852		probably null	Het
Lpar3	C	T	3: 146,240,593	R9C	possibly damaging	Het
Map1a	A	G	2: 121,300,533	E372G	probably damaging	Het
Map2	C	A	1: 66,380,768	T86K	probably damaging	Het
Map7	A	G	10: 20,273,883		probably null	Het
Mdn1	T	C	4: 32,701,713	V1482A	probably benign	Het
Mks1	G	A	11: 87,856,951		probably benign	Het
Morf4l1	T	G	9: 90,102,350	K102N	probably damaging	Het
Mroh1	T	A	15: 76,408,938	V304D	possibly damaging	Het
Mtg1	G	A	7: 140,149,752	V252M	probably damaging	Het
Myh13	A	T	11: 67,334,601	D264V	probably damaging	Het
Myh2	A	G	11: 67,186,508	Y823C	possibly damaging	Het
Myoz1	A	T	14: 20,651,184	S112R	probably benign	Het
Ncapd2	A	G	6: 125,173,482	V860A	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Npffr1	T	C	10: 61,614,231	F95L	possibly damaging	Het
Olfr585	G	T	7: 103,098,434	R231L	probably benign	Het
Olfr877	T	C	9: 37,855,196	I126T	probably damaging	Het
Orc4	A	C	2: 48,932,610		probably benign	Het
P3h3	A	C	6: 124,845,513	I565R	probably damaging	Het
Pak4	T	C	7: 28,559,777	D552G	probably benign	Het
Pcdhb4	G	T	18: 37,309,370		probably null	Het
Pdcd4	G	T	19: 53,929,094	R454L	probably damaging	Het
Pkd1l2	A	G	8: 117,044,492	I1116T	probably damaging	Het
Plcb2	A	G	2: 118,725,105		probably benign	Het
Pmpca	T	C	2: 26,393,218		probably benign	Het
Pnpla7	T	A	2: 24,997,240	I32N	probably damaging	Het
Prpf8	A	G	11: 75,493,949	K718E	probably damaging	Het
Racgap1	C	T	15: 99,626,530	A359T	probably benign	Het
Rgs3	G	A	4: 62,605,561		probably null	Het
Rhpn1	A	G	15: 75,711,654	E356G	probably damaging	Het
Rps6ka5	T	C	12: 100,574,438	H488R	possibly damaging	Het
Scn11a	A	G	9: 119,803,330		probably null	Het
Sema4f	A	T	6: 82,935,967		probably benign	Het
Serpina1f	A	G	12: 103,693,835	S63P	probably damaging	Het
Slc9b1	A	C	3: 135,394,890	L465F	probably benign	Het
Smc5	A	G	19: 23,263,653	V165A	possibly damaging	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tinagl1	G	T	4: 130,174,023	D59E	probably damaging	Het
Tns3	A	G	11: 8,493,302	Y354H	probably damaging	Het
Trappc9	C	T	15: 72,590,107	G1103D	probably damaging	Het
Unc79	A	T	12: 102,991,428	D34V	probably damaging	Het
Unc80	T	C	1: 66,521,486	L791P	probably damaging	Het
Xpo7	G	T	14: 70,666,097		probably benign	Het
Zbtb1	T	A	12: 76,385,339	I33N	probably damaging	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R2938:Slc9a3	UTSW	13	74121669	missense	possibly damaging	0.62
R4538:Slc9a3	UTSW	13	74161732	missense	possibly damaging	0.56
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5079:Slc9a3	UTSW	13	74164287	missense	probably damaging	0.97
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5876:Slc9a3	UTSW	13	74161723	missense	probably damaging	1.00
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6060:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8159:Slc9a3	UTSW	13	74164288	missense	probably benign	0.01
R8837:Slc9a3	UTSW	13	74157704	missense	probably damaging	1.00
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
R9111:Slc9a3	UTSW	13	74150801	missense	probably damaging	1.00
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTGCGCTACACTATGAAGATGCTG -3'
(R):5'- GCTGAGCCACACCTGAAAGATGAC -3'

Sequencing Primer
(F):5'- AGCACTCTTAGTAGTAGCTAGGCTC -3'
(R):5'- CACACCTGAAAGATGACTGTGAAG -3'

Posted On

2013-11-08