Mutagenetix > Incidental Mutation

Incidental Mutation 'R0893:Ddb1'

83629

Institutional Source

Beutler Lab

Gene Symbol

Ddb1

Ensembl Gene

ENSMUSG00000024740

Gene Name

damage specific DNA binding protein 1

Synonyms

DNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair

MMRRC Submission

039056-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0893 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10605625-10629813 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 10612916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 269 (S269L)

Ref Sequence

ENSEMBL: ENSMUSP00000025649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025649]

AlphaFold

Q3U1J4

Predicted Effect

probably benign
Transcript: ENSMUST00000025649
AA Change: S269L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: S269L

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	75	543	1.9e-122	PFAM
low complexity region	755	775	N/A	INTRINSIC
Pfam:CPSF_A	788	1099	1e-92	PFAM

Meta Mutation Damage Score

0.1086

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,219,308		probably benign	Het
4921501E09Rik	T	C	17: 33,065,289	I846M	probably benign	Het
Adnp	A	T	2: 168,183,727	F549L	possibly damaging	Het
Agl	A	G	3: 116,753,286	I1305T	probably benign	Het
Aldh8a1	T	A	10: 21,391,694	M326K	probably benign	Het
Amdhd1	A	T	10: 93,527,651	M295K	probably damaging	Het
Arhgef4	T	A	1: 34,807,110	C324S	probably damaging	Het
Car8	A	T	4: 8,238,119		probably null	Het
Cc2d1a	T	C	8: 84,140,839		probably benign	Het
Cd81	G	A	7: 143,062,505	V27M	possibly damaging	Het
Ces1b	A	T	8: 93,079,428	S62T	probably benign	Het
Cfb	A	G	17: 34,858,055	S30P	probably damaging	Het
Cmtm3	A	G	8: 104,343,911	M101V	possibly damaging	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Ddx25	G	A	9: 35,554,390	Q143*	probably null	Het
Dis3l2	T	A	1: 87,044,206		probably null	Het
Dlgap4	G	T	2: 156,745,978	E598*	probably null	Het
Dus1l	C	T	11: 120,789,436	G471D	possibly damaging	Het
Elp4	C	A	2: 105,896,945		probably benign	Het
Eya3	A	G	4: 132,689,786	N194S	probably benign	Het
Gm9992	A	G	17: 7,374,527	L174P	probably damaging	Het
Golgb1	G	T	16: 36,912,277	V629L	possibly damaging	Het
Hars2	G	A	18: 36,787,595	A164T	possibly damaging	Het
Hexb	T	A	13: 97,185,627	I217L	probably benign	Het
Hgh1	A	G	15: 76,369,648		probably null	Het
Hsd3b3	A	T	3: 98,742,441		probably null	Het
Ighg2c	T	A	12: 113,287,433	N321Y	unknown	Het
Il5	A	G	11: 53,720,936	T34A	probably benign	Het
Jph1	C	A	1: 17,004,283	E504*	probably null	Het
Kif2b	G	T	11: 91,575,594	T621K	probably benign	Het
Kmt2c	A	T	5: 25,351,270		probably benign	Het
Leprotl1	A	G	8: 34,138,852		probably null	Het
Lpar3	C	T	3: 146,240,593	R9C	possibly damaging	Het
Map1a	A	G	2: 121,300,533	E372G	probably damaging	Het
Map2	C	A	1: 66,380,768	T86K	probably damaging	Het
Map7	A	G	10: 20,273,883		probably null	Het
Mdn1	T	C	4: 32,701,713	V1482A	probably benign	Het
Mks1	G	A	11: 87,856,951		probably benign	Het
Morf4l1	T	G	9: 90,102,350	K102N	probably damaging	Het
Mroh1	T	A	15: 76,408,938	V304D	possibly damaging	Het
Mtg1	G	A	7: 140,149,752	V252M	probably damaging	Het
Myh13	A	T	11: 67,334,601	D264V	probably damaging	Het
Myh2	A	G	11: 67,186,508	Y823C	possibly damaging	Het
Myoz1	A	T	14: 20,651,184	S112R	probably benign	Het
Ncapd2	A	G	6: 125,173,482	V860A	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Npffr1	T	C	10: 61,614,231	F95L	possibly damaging	Het
Olfr585	G	T	7: 103,098,434	R231L	probably benign	Het
Olfr877	T	C	9: 37,855,196	I126T	probably damaging	Het
Orc4	A	C	2: 48,932,610		probably benign	Het
P3h3	A	C	6: 124,845,513	I565R	probably damaging	Het
Pak4	T	C	7: 28,559,777	D552G	probably benign	Het
Pcdhb4	G	T	18: 37,309,370		probably null	Het
Pdcd4	G	T	19: 53,929,094	R454L	probably damaging	Het
Pkd1l2	A	G	8: 117,044,492	I1116T	probably damaging	Het
Plcb2	A	G	2: 118,725,105		probably benign	Het
Pmpca	T	C	2: 26,393,218		probably benign	Het
Pnpla7	T	A	2: 24,997,240	I32N	probably damaging	Het
Prpf8	A	G	11: 75,493,949	K718E	probably damaging	Het
Racgap1	C	T	15: 99,626,530	A359T	probably benign	Het
Rgs3	G	A	4: 62,605,561		probably null	Het
Rhpn1	A	G	15: 75,711,654	E356G	probably damaging	Het
Rps6ka5	T	C	12: 100,574,438	H488R	possibly damaging	Het
Scn11a	A	G	9: 119,803,330		probably null	Het
Sema4f	A	T	6: 82,935,967		probably benign	Het
Serpina1f	A	G	12: 103,693,835	S63P	probably damaging	Het
Slc9a3	T	C	13: 74,159,246	W386R	probably damaging	Het
Slc9b1	A	C	3: 135,394,890	L465F	probably benign	Het
Smc5	A	G	19: 23,263,653	V165A	possibly damaging	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tinagl1	G	T	4: 130,174,023	D59E	probably damaging	Het
Tns3	A	G	11: 8,493,302	Y354H	probably damaging	Het
Trappc9	C	T	15: 72,590,107	G1103D	probably damaging	Het
Unc79	A	T	12: 102,991,428	D34V	probably damaging	Het
Unc80	T	C	1: 66,521,486	L791P	probably damaging	Het
Xpo7	G	T	14: 70,666,097		probably benign	Het
Zbtb1	T	A	12: 76,385,339	I33N	probably damaging	Het

Other mutations in Ddb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Ddb1	APN	19	10611664	missense	possibly damaging	0.85
IGL00742:Ddb1	APN	19	10610760	missense	probably benign
IGL01161:Ddb1	APN	19	10605707	start codon destroyed	probably null	1.00
IGL01364:Ddb1	APN	19	10627660	critical splice donor site	probably null
IGL01804:Ddb1	APN	19	10613018	missense	probably damaging	1.00
IGL01812:Ddb1	APN	19	10613018	missense	probably damaging	1.00
IGL02523:Ddb1	APN	19	10627632	missense	probably damaging	1.00
IGL02609:Ddb1	APN	19	10622466	missense	possibly damaging	0.93
IGL02664:Ddb1	APN	19	10607883	missense	probably benign
IGL03033:Ddb1	APN	19	10625926	missense	possibly damaging	0.59
IGL03092:Ddb1	APN	19	10612945	missense	probably damaging	1.00
IGL03110:Ddb1	APN	19	10612945	missense	probably damaging	1.00
IGL03256:Ddb1	APN	19	10621861	missense	probably benign	0.01
Dubitable	UTSW	19	10622499	critical splice donor site	probably null
Indubitable	UTSW	19	10607911	critical splice donor site	probably null
Van_der_waals	UTSW	19	10612916	missense	probably benign	0.11
PIT4445001:Ddb1	UTSW	19	10625970	missense	probably damaging	1.00
R0028:Ddb1	UTSW	19	10619246	missense	probably damaging	1.00
R0589:Ddb1	UTSW	19	10621716	missense	probably benign	0.02
R1374:Ddb1	UTSW	19	10608318	missense	probably damaging	1.00
R1611:Ddb1	UTSW	19	10612888	missense	probably damaging	1.00
R1611:Ddb1	UTSW	19	10626764	critical splice donor site	probably null
R1661:Ddb1	UTSW	19	10629080	missense	probably benign	0.00
R1835:Ddb1	UTSW	19	10626593	missense	probably damaging	1.00
R2036:Ddb1	UTSW	19	10610822	splice site	probably benign
R2094:Ddb1	UTSW	19	10612936	missense	probably benign
R2142:Ddb1	UTSW	19	10619126	critical splice donor site	probably null
R2213:Ddb1	UTSW	19	10608327	missense	probably damaging	1.00
R2318:Ddb1	UTSW	19	10626628	missense	probably damaging	1.00
R2354:Ddb1	UTSW	19	10606973	missense	probably benign	0.03
R3150:Ddb1	UTSW	19	10612982	missense	probably benign	0.02
R3162:Ddb1	UTSW	19	10625971	missense	probably damaging	0.99
R3162:Ddb1	UTSW	19	10625971	missense	probably damaging	0.99
R3606:Ddb1	UTSW	19	10628493	missense	probably damaging	1.00
R4050:Ddb1	UTSW	19	10627807	missense	probably benign	0.00
R5157:Ddb1	UTSW	19	10622364	missense	probably benign	0.01
R6244:Ddb1	UTSW	19	10625923	missense	probably damaging	0.99
R6249:Ddb1	UTSW	19	10605720	nonsense	probably null
R6812:Ddb1	UTSW	19	10622499	critical splice donor site	probably null
R7337:Ddb1	UTSW	19	10627831	missense	possibly damaging	0.88
R7460:Ddb1	UTSW	19	10607911	critical splice donor site	probably null
R7737:Ddb1	UTSW	19	10625974	missense	possibly damaging	0.93
R7903:Ddb1	UTSW	19	10608348	missense	probably benign	0.12
R8288:Ddb1	UTSW	19	10608348	missense	probably benign	0.12
R8376:Ddb1	UTSW	19	10619305	missense	probably damaging	1.00
R8970:Ddb1	UTSW	19	10608444	missense	probably benign	0.01
RF016:Ddb1	UTSW	19	10627858	missense	probably damaging	1.00
X0050:Ddb1	UTSW	19	10626659	missense	possibly damaging	0.95
Z1088:Ddb1	UTSW	19	10619230	missense	probably damaging	0.99
Z1177:Ddb1	UTSW	19	10608396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTGAGCTACACCTTGAGTTCTG -3'
(R):5'- GGAACCACACATTTGGGCTAAGCAC -3'

Sequencing Primer
(F):5'- GAAACTTATCTTCAAAGGCTGCCTG -3'
(R):5'- TTCCACTCGAAGGTCCTTGAG -3'

Posted On

2013-11-08