Incidental Mutation 'R0893:Ddb1'
ID83629
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Namedamage specific DNA binding protein 1
SynonymsDNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair
MMRRC Submission 039056-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0893 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10605625-10629813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10612916 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 269 (S269L)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
Predicted Effect probably benign
Transcript: ENSMUST00000025649
AA Change: S269L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: S269L

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,219,308 probably benign Het
4921501E09Rik T C 17: 33,065,289 I846M probably benign Het
Adnp A T 2: 168,183,727 F549L possibly damaging Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Aldh8a1 T A 10: 21,391,694 M326K probably benign Het
Amdhd1 A T 10: 93,527,651 M295K probably damaging Het
Arhgef4 T A 1: 34,807,110 C324S probably damaging Het
Car8 A T 4: 8,238,119 probably null Het
Cc2d1a T C 8: 84,140,839 probably benign Het
Cd81 G A 7: 143,062,505 V27M possibly damaging Het
Ces1b A T 8: 93,079,428 S62T probably benign Het
Cfb A G 17: 34,858,055 S30P probably damaging Het
Cmtm3 A G 8: 104,343,911 M101V possibly damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Ddx25 G A 9: 35,554,390 Q143* probably null Het
Dis3l2 T A 1: 87,044,206 probably null Het
Dlgap4 G T 2: 156,745,978 E598* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Elp4 C A 2: 105,896,945 probably benign Het
Eya3 A G 4: 132,689,786 N194S probably benign Het
Gm9992 A G 17: 7,374,527 L174P probably damaging Het
Golgb1 G T 16: 36,912,277 V629L possibly damaging Het
Hars2 G A 18: 36,787,595 A164T possibly damaging Het
Hexb T A 13: 97,185,627 I217L probably benign Het
Hgh1 A G 15: 76,369,648 probably null Het
Hsd3b3 A T 3: 98,742,441 probably null Het
Ighg2c T A 12: 113,287,433 N321Y unknown Het
Il5 A G 11: 53,720,936 T34A probably benign Het
Jph1 C A 1: 17,004,283 E504* probably null Het
Kif2b G T 11: 91,575,594 T621K probably benign Het
Kmt2c A T 5: 25,351,270 probably benign Het
Leprotl1 A G 8: 34,138,852 probably null Het
Lpar3 C T 3: 146,240,593 R9C possibly damaging Het
Map1a A G 2: 121,300,533 E372G probably damaging Het
Map2 C A 1: 66,380,768 T86K probably damaging Het
Map7 A G 10: 20,273,883 probably null Het
Mdn1 T C 4: 32,701,713 V1482A probably benign Het
Mks1 G A 11: 87,856,951 probably benign Het
Morf4l1 T G 9: 90,102,350 K102N probably damaging Het
Mroh1 T A 15: 76,408,938 V304D possibly damaging Het
Mtg1 G A 7: 140,149,752 V252M probably damaging Het
Myh13 A T 11: 67,334,601 D264V probably damaging Het
Myh2 A G 11: 67,186,508 Y823C possibly damaging Het
Myoz1 A T 14: 20,651,184 S112R probably benign Het
Ncapd2 A G 6: 125,173,482 V860A probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Npffr1 T C 10: 61,614,231 F95L possibly damaging Het
Olfr585 G T 7: 103,098,434 R231L probably benign Het
Olfr877 T C 9: 37,855,196 I126T probably damaging Het
Orc4 A C 2: 48,932,610 probably benign Het
P3h3 A C 6: 124,845,513 I565R probably damaging Het
Pak4 T C 7: 28,559,777 D552G probably benign Het
Pcdhb4 G T 18: 37,309,370 probably null Het
Pdcd4 G T 19: 53,929,094 R454L probably damaging Het
Pkd1l2 A G 8: 117,044,492 I1116T probably damaging Het
Plcb2 A G 2: 118,725,105 probably benign Het
Pmpca T C 2: 26,393,218 probably benign Het
Pnpla7 T A 2: 24,997,240 I32N probably damaging Het
Prpf8 A G 11: 75,493,949 K718E probably damaging Het
Racgap1 C T 15: 99,626,530 A359T probably benign Het
Rgs3 G A 4: 62,605,561 probably null Het
Rhpn1 A G 15: 75,711,654 E356G probably damaging Het
Rps6ka5 T C 12: 100,574,438 H488R possibly damaging Het
Scn11a A G 9: 119,803,330 probably null Het
Sema4f A T 6: 82,935,967 probably benign Het
Serpina1f A G 12: 103,693,835 S63P probably damaging Het
Slc9a3 T C 13: 74,159,246 W386R probably damaging Het
Slc9b1 A C 3: 135,394,890 L465F probably benign Het
Smc5 A G 19: 23,263,653 V165A possibly damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tinagl1 G T 4: 130,174,023 D59E probably damaging Het
Tns3 A G 11: 8,493,302 Y354H probably damaging Het
Trappc9 C T 15: 72,590,107 G1103D probably damaging Het
Unc79 A T 12: 102,991,428 D34V probably damaging Het
Unc80 T C 1: 66,521,486 L791P probably damaging Het
Xpo7 G T 14: 70,666,097 probably benign Het
Zbtb1 T A 12: 76,385,339 I33N probably damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10611664 missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10610760 missense probably benign
IGL01161:Ddb1 APN 19 10605707 start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10627660 critical splice donor site probably null
IGL01804:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10627632 missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10622466 missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10607883 missense probably benign
IGL03033:Ddb1 APN 19 10625926 missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10621861 missense probably benign 0.01
Dubitable UTSW 19 10622499 critical splice donor site probably null
Indubitable UTSW 19 10607911 critical splice donor site probably null
Van_der_waals UTSW 19 10612916 missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10625970 missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10619246 missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10621716 missense probably benign 0.02
R1374:Ddb1 UTSW 19 10608318 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10612888 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10626764 critical splice donor site probably null
R1661:Ddb1 UTSW 19 10629080 missense probably benign 0.00
R1835:Ddb1 UTSW 19 10626593 missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10610822 splice site probably benign
R2094:Ddb1 UTSW 19 10612936 missense probably benign
R2142:Ddb1 UTSW 19 10619126 critical splice donor site probably null
R2213:Ddb1 UTSW 19 10608327 missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10626628 missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10606973 missense probably benign 0.03
R3150:Ddb1 UTSW 19 10612982 missense probably benign 0.02
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10628493 missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10627807 missense probably benign 0.00
R5157:Ddb1 UTSW 19 10622364 missense probably benign 0.01
R6244:Ddb1 UTSW 19 10625923 missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10605720 nonsense probably null
R6812:Ddb1 UTSW 19 10622499 critical splice donor site probably null
R7337:Ddb1 UTSW 19 10627831 missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10607911 critical splice donor site probably null
R7737:Ddb1 UTSW 19 10625974 missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10608348 missense probably benign 0.12
R8288:Ddb1 UTSW 19 10608348 missense probably benign 0.12
R8376:Ddb1 UTSW 19 10619305 missense probably damaging 1.00
RF016:Ddb1 UTSW 19 10627858 missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10626659 missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10619230 missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10608396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGAGCTACACCTTGAGTTCTG -3'
(R):5'- GGAACCACACATTTGGGCTAAGCAC -3'

Sequencing Primer
(F):5'- GAAACTTATCTTCAAAGGCTGCCTG -3'
(R):5'- TTCCACTCGAAGGTCCTTGAG -3'
Posted On2013-11-08