Incidental Mutation 'R0893:Ddb1'
ID 83629
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Name damage specific DNA binding protein 1
Synonyms damage-specific DNA-binding protein, DNA repair, p127-Ddb1, DNA repair protein
MMRRC Submission 039056-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0893 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 10582961-10607186 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 10590280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 269 (S269L)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
AlphaFold Q3U1J4
Predicted Effect probably benign
Transcript: ENSMUST00000025649
AA Change: S269L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: S269L

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,266,082 (GRCm39) probably benign Het
Adnp A T 2: 168,025,647 (GRCm39) F549L possibly damaging Het
Agl A G 3: 116,546,935 (GRCm39) I1305T probably benign Het
Aldh8a1 T A 10: 21,267,593 (GRCm39) M326K probably benign Het
Amdhd1 A T 10: 93,363,513 (GRCm39) M295K probably damaging Het
Arhgef4 T A 1: 34,846,191 (GRCm39) C324S probably damaging Het
Car8 A T 4: 8,238,119 (GRCm39) probably null Het
Cc2d1a T C 8: 84,867,468 (GRCm39) probably benign Het
Cd81 G A 7: 142,616,242 (GRCm39) V27M possibly damaging Het
Ces1b A T 8: 93,806,056 (GRCm39) S62T probably benign Het
Cfb A G 17: 35,077,031 (GRCm39) S30P probably damaging Het
Cmtm3 A G 8: 105,070,543 (GRCm39) M101V possibly damaging Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Ddx25 G A 9: 35,465,686 (GRCm39) Q143* probably null Het
Dis3l2 T A 1: 86,971,928 (GRCm39) probably null Het
Dlgap4 G T 2: 156,587,898 (GRCm39) E598* probably null Het
Dus1l C T 11: 120,680,262 (GRCm39) G471D possibly damaging Het
Elp4 C A 2: 105,727,290 (GRCm39) probably benign Het
Eya3 A G 4: 132,417,097 (GRCm39) N194S probably benign Het
Golgb1 G T 16: 36,732,639 (GRCm39) V629L possibly damaging Het
Hars2 G A 18: 36,920,648 (GRCm39) A164T possibly damaging Het
Hexb T A 13: 97,322,135 (GRCm39) I217L probably benign Het
Hgh1 A G 15: 76,253,848 (GRCm39) probably null Het
Hsd3b3 A T 3: 98,649,757 (GRCm39) probably null Het
Ighg2c T A 12: 113,251,053 (GRCm39) N321Y unknown Het
Il5 A G 11: 53,611,763 (GRCm39) T34A probably benign Het
Jph1 C A 1: 17,074,507 (GRCm39) E504* probably null Het
Kif2b G T 11: 91,466,420 (GRCm39) T621K probably benign Het
Kmt2c A T 5: 25,556,268 (GRCm39) probably benign Het
Leprotl1 A G 8: 34,606,006 (GRCm39) probably null Het
Lpar3 C T 3: 145,946,348 (GRCm39) R9C possibly damaging Het
Map1a A G 2: 121,131,014 (GRCm39) E372G probably damaging Het
Map2 C A 1: 66,419,927 (GRCm39) T86K probably damaging Het
Map7 A G 10: 20,149,629 (GRCm39) probably null Het
Mdn1 T C 4: 32,701,713 (GRCm39) V1482A probably benign Het
Mks1 G A 11: 87,747,777 (GRCm39) probably benign Het
Morf4l1 T G 9: 89,984,403 (GRCm39) K102N probably damaging Het
Mroh1 T A 15: 76,293,138 (GRCm39) V304D possibly damaging Het
Mtg1 G A 7: 139,729,665 (GRCm39) V252M probably damaging Het
Myh13 A T 11: 67,225,427 (GRCm39) D264V probably damaging Het
Myh2 A G 11: 67,077,334 (GRCm39) Y823C possibly damaging Het
Myoz1 A T 14: 20,701,252 (GRCm39) S112R probably benign Het
Ncapd2 A G 6: 125,150,445 (GRCm39) V860A probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Npffr1 T C 10: 61,450,010 (GRCm39) F95L possibly damaging Het
Or51f1e G T 7: 102,747,641 (GRCm39) R231L probably benign Het
Or8b9 T C 9: 37,766,492 (GRCm39) I126T probably damaging Het
Orc4 A C 2: 48,822,622 (GRCm39) probably benign Het
P3h3 A C 6: 124,822,476 (GRCm39) I565R probably damaging Het
Pak4 T C 7: 28,259,202 (GRCm39) D552G probably benign Het
Pcdhb4 G T 18: 37,442,423 (GRCm39) probably null Het
Pdcd4 G T 19: 53,917,525 (GRCm39) R454L probably damaging Het
Phf8-ps T C 17: 33,284,263 (GRCm39) I846M probably benign Het
Pkd1l2 A G 8: 117,771,231 (GRCm39) I1116T probably damaging Het
Plcb2 A G 2: 118,555,586 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,230 (GRCm39) probably benign Het
Pnpla7 T A 2: 24,887,252 (GRCm39) I32N probably damaging Het
Prpf8 A G 11: 75,384,775 (GRCm39) K718E probably damaging Het
Racgap1 C T 15: 99,524,411 (GRCm39) A359T probably benign Het
Rgs3 G A 4: 62,523,798 (GRCm39) probably null Het
Rhpn1 A G 15: 75,583,503 (GRCm39) E356G probably damaging Het
Rps6ka5 T C 12: 100,540,697 (GRCm39) H488R possibly damaging Het
Scn11a A G 9: 119,632,396 (GRCm39) probably null Het
Sema4f A T 6: 82,912,948 (GRCm39) probably benign Het
Serpina1f A G 12: 103,660,094 (GRCm39) S63P probably damaging Het
Slc9a3 T C 13: 74,307,365 (GRCm39) W386R probably damaging Het
Slc9b1 A C 3: 135,100,651 (GRCm39) L465F probably benign Het
Smc5 A G 19: 23,241,017 (GRCm39) V165A possibly damaging Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tinagl1 G T 4: 130,067,816 (GRCm39) D59E probably damaging Het
Tns3 A G 11: 8,443,302 (GRCm39) Y354H probably damaging Het
Trappc9 C T 15: 72,461,956 (GRCm39) G1103D probably damaging Het
Unc79 A T 12: 102,957,687 (GRCm39) D34V probably damaging Het
Unc80 T C 1: 66,560,645 (GRCm39) L791P probably damaging Het
Unc93a2 A G 17: 7,641,926 (GRCm39) L174P probably damaging Het
Xpo7 G T 14: 70,903,537 (GRCm39) probably benign Het
Zbtb1 T A 12: 76,432,113 (GRCm39) I33N probably damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10,589,028 (GRCm39) missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10,588,124 (GRCm39) missense probably benign
IGL01161:Ddb1 APN 19 10,583,071 (GRCm39) start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10,605,024 (GRCm39) critical splice donor site probably null
IGL01804:Ddb1 APN 19 10,590,382 (GRCm39) missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10,590,382 (GRCm39) missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10,604,996 (GRCm39) missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10,599,830 (GRCm39) missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10,585,247 (GRCm39) missense probably benign
IGL03033:Ddb1 APN 19 10,603,290 (GRCm39) missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10,590,309 (GRCm39) missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10,590,309 (GRCm39) missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10,599,225 (GRCm39) missense probably benign 0.01
Dubitable UTSW 19 10,599,863 (GRCm39) critical splice donor site probably null
Indubitable UTSW 19 10,585,275 (GRCm39) critical splice donor site probably null
Van_der_waals UTSW 19 10,590,280 (GRCm39) missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10,603,334 (GRCm39) missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10,596,610 (GRCm39) missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10,599,080 (GRCm39) missense probably benign 0.02
R1374:Ddb1 UTSW 19 10,585,682 (GRCm39) missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10,604,128 (GRCm39) critical splice donor site probably null
R1611:Ddb1 UTSW 19 10,590,252 (GRCm39) missense probably damaging 1.00
R1661:Ddb1 UTSW 19 10,606,444 (GRCm39) missense probably benign 0.00
R1835:Ddb1 UTSW 19 10,603,957 (GRCm39) missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10,588,186 (GRCm39) splice site probably benign
R2094:Ddb1 UTSW 19 10,590,300 (GRCm39) missense probably benign
R2142:Ddb1 UTSW 19 10,596,490 (GRCm39) critical splice donor site probably null
R2213:Ddb1 UTSW 19 10,585,691 (GRCm39) missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10,603,992 (GRCm39) missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10,584,337 (GRCm39) missense probably benign 0.03
R3150:Ddb1 UTSW 19 10,590,346 (GRCm39) missense probably benign 0.02
R3162:Ddb1 UTSW 19 10,603,335 (GRCm39) missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10,603,335 (GRCm39) missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10,605,857 (GRCm39) missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10,605,171 (GRCm39) missense probably benign 0.00
R5157:Ddb1 UTSW 19 10,599,728 (GRCm39) missense probably benign 0.01
R6244:Ddb1 UTSW 19 10,603,287 (GRCm39) missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10,583,084 (GRCm39) nonsense probably null
R6812:Ddb1 UTSW 19 10,599,863 (GRCm39) critical splice donor site probably null
R7337:Ddb1 UTSW 19 10,605,195 (GRCm39) missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10,585,275 (GRCm39) critical splice donor site probably null
R7737:Ddb1 UTSW 19 10,603,338 (GRCm39) missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10,585,712 (GRCm39) missense probably benign 0.12
R8288:Ddb1 UTSW 19 10,585,712 (GRCm39) missense probably benign 0.12
R8376:Ddb1 UTSW 19 10,596,669 (GRCm39) missense probably damaging 1.00
R8970:Ddb1 UTSW 19 10,585,808 (GRCm39) missense probably benign 0.01
R9720:Ddb1 UTSW 19 10,585,724 (GRCm39) missense probably benign
RF016:Ddb1 UTSW 19 10,605,222 (GRCm39) missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10,604,023 (GRCm39) missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10,596,594 (GRCm39) missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10,585,760 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGAGCTACACCTTGAGTTCTG -3'
(R):5'- GGAACCACACATTTGGGCTAAGCAC -3'

Sequencing Primer
(F):5'- GAAACTTATCTTCAAAGGCTGCCTG -3'
(R):5'- TTCCACTCGAAGGTCCTTGAG -3'
Posted On 2013-11-08