Incidental Mutation 'R0894:Pcnx2'
ID83670
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission 039057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0894 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 125886926 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239] [ENSMUST00000131127]
Predicted Effect probably benign
Transcript: ENSMUST00000047239
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131127
SMART Domains Protein: ENSMUSP00000119965
Gene: ENSMUSG00000060212

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 968 990 N/A INTRINSIC
transmembrane domain 1010 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187772
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 97% (102/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,787,583 L138Q probably damaging Het
1700028P14Rik T C 19: 23,652,698 E10G unknown Het
1700029J07Rik A G 8: 45,956,460 F274S probably damaging Het
2210408I21Rik A G 13: 77,323,607 S1044G probably benign Het
4930578C19Rik T A X: 18,423,552 I224F possibly damaging Het
4931409K22Rik T C 5: 24,550,733 probably null Het
9930021J03Rik T C 19: 29,720,574 probably benign Het
Aanat A G 11: 116,596,904 H143R probably benign Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcb1a G T 5: 8,674,856 probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Alk T C 17: 71,895,935 Y1135C probably damaging Het
Atad2b C T 12: 4,965,915 T547I probably damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Clec4f T A 6: 83,652,997 N193I probably damaging Het
Col4a4 A T 1: 82,529,656 probably null Het
Cplx4 T G 18: 65,957,045 D101A possibly damaging Het
Cpne8 A T 15: 90,649,271 D50E probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Ctdp1 A G 18: 80,469,521 V9A probably benign Het
Ctnnd2 A T 15: 30,332,155 probably benign Het
Cyp7b1 C T 3: 18,097,510 A180T probably benign Het
D3Ertd254e T A 3: 36,164,786 Y319* probably null Het
Dcun1d5 C T 9: 7,203,379 probably benign Het
Dgat1 G T 15: 76,502,999 L363I possibly damaging Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dnah6 T C 6: 73,124,757 N1928S probably benign Het
Dync2h1 A T 9: 7,041,734 probably benign Het
Ednra T G 8: 77,720,020 probably benign Het
Efcab6 A T 15: 83,918,292 C845S probably benign Het
Egln1 A T 8: 124,915,696 C303S probably damaging Het
Eomes T C 9: 118,482,300 probably null Het
Epha1 A G 6: 42,363,822 V568A probably benign Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Fbxo46 T C 7: 19,135,729 V91A probably damaging Het
Fryl A T 5: 73,041,332 probably benign Het
Gab3 A C X: 75,033,418 D43E probably damaging Het
Gltpd2 T A 11: 70,519,709 probably benign Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm7353 T C 7: 3,110,570 noncoding transcript Het
Grik4 T C 9: 42,688,109 probably benign Het
Gtpbp2 G T 17: 46,165,969 A358S possibly damaging Het
Hyls1 C T 9: 35,561,232 C296Y probably damaging Het
Igf2r C T 17: 12,692,101 M1943I probably benign Het
Ireb2 T A 9: 54,896,577 N517K probably damaging Het
Itga10 A G 3: 96,653,660 S614G possibly damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif17 T C 4: 138,298,231 M948T possibly damaging Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Llph T A 10: 120,228,181 C67* probably null Het
Lrrn3 T C 12: 41,454,034 T95A probably damaging Het
Map3k12 C A 15: 102,502,178 A455S probably damaging Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Myo7b A G 18: 32,000,070 W409R probably damaging Het
Nbea A G 3: 56,009,340 M833T possibly damaging Het
Ncapg A G 5: 45,679,894 T436A probably null Het
Nkx1-2 C A 7: 132,599,313 D72Y probably null Het
Olfr1532-ps1 T A 7: 106,915,110 I304K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr815 T A 10: 129,901,882 N276I probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcsk1 G A 13: 75,097,977 G158D probably damaging Het
Phkb A T 8: 86,017,441 D573V probably damaging Het
Pik3r4 A G 9: 105,667,771 K150E possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Ppp4r4 C T 12: 103,600,495 A67V probably damaging Het
Prex2 A G 1: 11,181,898 T1056A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Psd T C 19: 46,313,441 E903G probably damaging Het
Psg19 T C 7: 18,794,062 E252G probably benign Het
Psg20 T A 7: 18,681,044 K306* probably null Het
Pygl T G 12: 70,194,374 probably benign Het
Rasgrf2 A G 13: 91,982,771 S724P probably damaging Het
Reck C A 4: 43,922,967 A414D probably damaging Het
Scn10a C A 9: 119,630,147 V1150L probably damaging Het
Shc2 A T 10: 79,629,917 I187N probably damaging Het
Sipa1l3 T A 7: 29,387,291 K625* probably null Het
Slc44a4 T C 17: 34,928,490 L583P possibly damaging Het
Slc5a11 G C 7: 123,258,420 R244P possibly damaging Het
Slfn8 T A 11: 83,003,581 Q744L probably benign Het
Snx2 G T 18: 53,176,416 V13L probably benign Het
Spsb1 C T 4: 149,906,415 probably null Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Svil G T 18: 5,097,494 R1659L probably damaging Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tmem9 A T 1: 136,034,188 T174S possibly damaging Het
Tnks2 T C 19: 36,890,050 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ttf2 A G 3: 100,969,549 probably benign Het
Ubr7 C A 12: 102,769,191 T303N probably damaging Het
Ushbp1 A T 8: 71,390,224 probably null Het
Vmn1r177 C A 7: 23,866,050 V134F probably benign Het
Vmn2r12 A G 5: 109,087,850 probably null Het
Vmn2r53 T G 7: 12,601,214 H173P probably benign Het
Wdr78 T C 4: 103,049,386 probably benign Het
Yars A T 4: 129,197,155 M119L probably damaging Het
Zcrb1 A T 15: 93,397,157 probably benign Het
Zfp319 C A 8: 95,329,622 probably benign Het
Zfp783 C G 6: 47,943,386 noncoding transcript Het
Zfyve26 A G 12: 79,273,598 I1024T possibly damaging Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
gallen UTSW 8 125891120 missense probably damaging 1.00
hotzone UTSW 8 125891141 missense probably benign 0.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 splice site probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 splice site probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
R7271:Pcnx2 UTSW 8 125886951 missense probably benign
R7326:Pcnx2 UTSW 8 125887083 missense probably damaging 1.00
R7373:Pcnx2 UTSW 8 125808027 missense probably damaging 1.00
R7397:Pcnx2 UTSW 8 125890885 splice site probably null
R7662:Pcnx2 UTSW 8 125818771 nonsense probably null
R7693:Pcnx2 UTSW 8 125887125 missense probably benign 0.09
R7726:Pcnx2 UTSW 8 125850330 missense probably benign 0.00
R7745:Pcnx2 UTSW 8 125851107 missense probably benign 0.04
R7792:Pcnx2 UTSW 8 125892018 missense possibly damaging 0.63
R7797:Pcnx2 UTSW 8 125785348 missense possibly damaging 0.70
R7921:Pcnx2 UTSW 8 125837863 missense probably benign
R7984:Pcnx2 UTSW 8 125759126 missense probably benign
R8098:Pcnx2 UTSW 8 125768301 missense probably damaging 1.00
R8277:Pcnx2 UTSW 8 125866016 missense probably damaging 1.00
R8312:Pcnx2 UTSW 8 125762850 missense possibly damaging 0.69
R8354:Pcnx2 UTSW 8 125761618 missense probably damaging 0.99
R8378:Pcnx2 UTSW 8 125760910 missense probably damaging 1.00
R8713:Pcnx2 UTSW 8 125818786 missense probably damaging 1.00
R8714:Pcnx2 UTSW 8 125773807 missense probably benign
R8753:Pcnx2 UTSW 8 125887260 missense probably benign 0.15
R8790:Pcnx2 UTSW 8 125877567 missense probably benign
R8925:Pcnx2 UTSW 8 125887920 missense probably benign 0.01
R8927:Pcnx2 UTSW 8 125887920 missense probably benign 0.01
RF018:Pcnx2 UTSW 8 125877519 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125761654 missense probably damaging 1.00
Z1176:Pcnx2 UTSW 8 125838014 missense probably benign 0.30
Z1177:Pcnx2 UTSW 8 125887960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAACCCATGTAATAAGCATGGTAGCAGA -3'
(R):5'- GTCAGACCTGGAGGCCAAGGAA -3'

Sequencing Primer
(F):5'- ggtctgtcctctgacctctg -3'
(R):5'- GAAGGACAGATTCCAAATGAATCC -3'
Posted On2013-11-08