Incidental Mutation 'R0894:Pcdh15'
ID83679
Institutional Source Beutler Lab
Gene Symbol Pcdh15
Ensembl Gene ENSMUSG00000052613
Gene Nameprotocadherin 15
SynonymsGm9815, nmf19, Ush1f
MMRRC Submission 039057-MU
Accession Numbers

Genbank: NM_023115; Ensembl: ENSMUST00000105425

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0894 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location73099342-74649737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74624255 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1308 (Y1308C)
Ref Sequence ENSEMBL: ENSMUSP00000122940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064562] [ENSMUST00000092420] [ENSMUST00000105424] [ENSMUST00000105426] [ENSMUST00000105429] [ENSMUST00000124046] [ENSMUST00000125055] [ENSMUST00000125517] [ENSMUST00000126920] [ENSMUST00000129404] [ENSMUST00000131321] [ENSMUST00000131724] [ENSMUST00000136096] [ENSMUST00000144302] [ENSMUST00000146682] [ENSMUST00000147189] [ENSMUST00000149977] [ENSMUST00000151116] [ENSMUST00000152655] [ENSMUST00000152819] [ENSMUST00000155701] [ENSMUST00000177107] [ENSMUST00000191709] [ENSMUST00000191854] [ENSMUST00000193174] [ENSMUST00000193361] [ENSMUST00000193739] [ENSMUST00000194315] [ENSMUST00000195531]
Predicted Effect probably damaging
Transcript: ENSMUST00000064562
AA Change: Y1274C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068561
Gene: ENSMUSG00000052613
AA Change: Y1274C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 644 2.34e-16 SMART
CA 668 746 1.93e-26 SMART
CA 770 853 5.69e-15 SMART
CA 877 963 6.85e-9 SMART
CA 984 1071 3.09e-16 SMART
CA 1095 1179 4.49e-4 SMART
transmembrane domain 1304 1326 N/A INTRINSIC
low complexity region 1347 1374 N/A INTRINSIC
low complexity region 1583 1600 N/A INTRINSIC
low complexity region 1662 1682 N/A INTRINSIC
low complexity region 1689 1702 N/A INTRINSIC
low complexity region 1706 1756 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092420
AA Change: Y1345C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090076
Gene: ENSMUSG00000052613
AA Change: Y1345C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1377 1399 N/A INTRINSIC
low complexity region 1415 1442 N/A INTRINSIC
low complexity region 1651 1668 N/A INTRINSIC
low complexity region 1730 1750 N/A INTRINSIC
low complexity region 1757 1770 N/A INTRINSIC
low complexity region 1774 1824 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105424
AA Change: Y1345C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101064
Gene: ENSMUSG00000052613
AA Change: Y1345C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1656 1673 N/A INTRINSIC
low complexity region 1735 1755 N/A INTRINSIC
low complexity region 1762 1775 N/A INTRINSIC
low complexity region 1779 1829 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105426
AA Change: Y1345C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101066
Gene: ENSMUSG00000052613
AA Change: Y1345C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1661 1678 N/A INTRINSIC
low complexity region 1740 1760 N/A INTRINSIC
low complexity region 1767 1780 N/A INTRINSIC
low complexity region 1784 1834 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105429
AA Change: Y1274C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101069
Gene: ENSMUSG00000052613
AA Change: Y1274C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 644 2.34e-16 SMART
CA 668 746 1.93e-26 SMART
CA 770 853 5.69e-15 SMART
CA 877 963 6.85e-9 SMART
CA 984 1071 3.09e-16 SMART
CA 1095 1179 4.49e-4 SMART
transmembrane domain 1304 1326 N/A INTRINSIC
low complexity region 1347 1374 N/A INTRINSIC
low complexity region 1585 1602 N/A INTRINSIC
low complexity region 1664 1684 N/A INTRINSIC
low complexity region 1691 1704 N/A INTRINSIC
low complexity region 1708 1758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124046
AA Change: Y956C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121130
Gene: ENSMUSG00000052613
AA Change: Y956C

DomainStartEndE-ValueType
CA 30 118 7.87e-9 SMART
CA 142 224 4.88e-14 SMART
CA 249 326 4.65e-20 SMART
CA 350 428 1.93e-26 SMART
CA 452 535 5.69e-15 SMART
CA 559 645 6.85e-9 SMART
CA 666 753 3.09e-16 SMART
CA 777 861 4.49e-4 SMART
transmembrane domain 986 1008 N/A INTRINSIC
low complexity region 1029 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125055
SMART Domains Protein: ENSMUSP00000114326
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
low complexity region 649 665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125517
SMART Domains Protein: ENSMUSP00000115399
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
low complexity region 430 468 N/A INTRINSIC
low complexity region 521 584 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126920
AA Change: Y1323C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121939
Gene: ENSMUSG00000052613
AA Change: Y1323C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 42 123 1.22e-1 SMART
CA 152 241 5.48e-8 SMART
CA 282 371 1.94e-8 SMART
CA 404 485 2.29e-10 SMART
CA 509 591 4.88e-14 SMART
CA 616 693 4.65e-20 SMART
CA 717 795 1.93e-26 SMART
CA 819 902 5.69e-15 SMART
CA 926 1012 6.85e-9 SMART
CA 1033 1120 3.09e-16 SMART
CA 1144 1228 4.49e-4 SMART
transmembrane domain 1353 1375 N/A INTRINSIC
low complexity region 1396 1423 N/A INTRINSIC
low complexity region 1634 1651 N/A INTRINSIC
low complexity region 1713 1733 N/A INTRINSIC
low complexity region 1740 1753 N/A INTRINSIC
low complexity region 1757 1807 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128843
Predicted Effect probably damaging
Transcript: ENSMUST00000129404
AA Change: Y1323C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117731
Gene: ENSMUSG00000052613
AA Change: Y1323C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 42 123 1.22e-1 SMART
CA 152 241 5.48e-8 SMART
CA 282 371 1.94e-8 SMART
CA 404 485 2.29e-10 SMART
CA 509 591 4.88e-14 SMART
CA 616 693 4.65e-20 SMART
CA 717 795 1.93e-26 SMART
CA 819 902 5.69e-15 SMART
CA 926 1012 6.85e-9 SMART
CA 1033 1120 3.09e-16 SMART
CA 1144 1228 4.49e-4 SMART
transmembrane domain 1355 1377 N/A INTRINSIC
low complexity region 1393 1420 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1710 1730 N/A INTRINSIC
low complexity region 1737 1750 N/A INTRINSIC
low complexity region 1754 1804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131321
AA Change: Y1345C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122911
Gene: ENSMUSG00000052613
AA Change: Y1345C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1654 1671 N/A INTRINSIC
low complexity region 1733 1753 N/A INTRINSIC
low complexity region 1760 1773 N/A INTRINSIC
low complexity region 1777 1827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131724
AA Change: Y1345C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122466
Gene: ENSMUSG00000052613
AA Change: Y1345C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136096
SMART Domains Protein: ENSMUSP00000121534
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
low complexity region 649 665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144302
SMART Domains Protein: ENSMUSP00000122606
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
low complexity region 313 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146682
AA Change: Y98C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134863
Gene: ENSMUSG00000052613
AA Change: Y98C

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147189
AA Change: Y1308C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122940
Gene: ENSMUSG00000052613
AA Change: Y1308C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
low complexity region 209 225 N/A INTRINSIC
CA 267 356 1.94e-8 SMART
CA 389 470 2.29e-10 SMART
CA 494 576 4.88e-14 SMART
CA 601 678 4.65e-20 SMART
CA 702 780 1.93e-26 SMART
CA 804 887 5.69e-15 SMART
CA 911 997 6.85e-9 SMART
CA 1018 1105 3.09e-16 SMART
CA 1129 1213 4.49e-4 SMART
transmembrane domain 1340 1362 N/A INTRINSIC
low complexity region 1378 1405 N/A INTRINSIC
low complexity region 1614 1631 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
low complexity region 1720 1733 N/A INTRINSIC
low complexity region 1737 1787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149977
AA Change: Y1345C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118833
Gene: ENSMUSG00000052613
AA Change: Y1345C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151116
AA Change: Y1357C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119662
Gene: ENSMUSG00000052613
AA Change: Y1357C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 519 7.87e-9 SMART
CA 543 625 4.88e-14 SMART
CA 650 727 4.65e-20 SMART
CA 751 829 1.93e-26 SMART
CA 853 936 5.69e-15 SMART
CA 960 1046 6.85e-9 SMART
CA 1067 1154 3.09e-16 SMART
CA 1178 1262 4.49e-4 SMART
transmembrane domain 1387 1409 N/A INTRINSIC
low complexity region 1430 1457 N/A INTRINSIC
low complexity region 1489 1519 N/A INTRINSIC
low complexity region 1521 1539 N/A INTRINSIC
low complexity region 1592 1655 N/A INTRINSIC
low complexity region 1681 1712 N/A INTRINSIC
low complexity region 1728 1756 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152655
SMART Domains Protein: ENSMUSP00000118201
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 726 3.4e-6 SMART
low complexity region 783 846 N/A INTRINSIC
low complexity region 872 903 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152819
SMART Domains Protein: ENSMUSP00000123647
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 363 1e-33 BLAST
low complexity region 364 399 N/A INTRINSIC
low complexity region 452 515 N/A INTRINSIC
low complexity region 541 572 N/A INTRINSIC
low complexity region 588 616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155701
SMART Domains Protein: ENSMUSP00000135495
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 330 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177107
AA Change: Y1350C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135501
Gene: ENSMUSG00000052613
AA Change: Y1350C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1482 1499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191709
AA Change: Y1350C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142313
Gene: ENSMUSG00000052613
AA Change: Y1350C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1480 1510 N/A INTRINSIC
low complexity region 1512 1530 N/A INTRINSIC
low complexity region 1583 1646 N/A INTRINSIC
low complexity region 1672 1703 N/A INTRINSIC
low complexity region 1719 1747 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191854
AA Change: Y1345C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141973
Gene: ENSMUSG00000052613
AA Change: Y1345C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193174
AA Change: Y1352C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142238
Gene: ENSMUSG00000052613
AA Change: Y1352C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 514 3.8e-11 SMART
CA 538 620 2.3e-16 SMART
CA 645 722 2.3e-22 SMART
CA 746 824 9.3e-29 SMART
CA 848 931 2.8e-17 SMART
CA 955 1041 3.3e-11 SMART
CA 1062 1149 1.5e-18 SMART
CA 1173 1257 2.3e-6 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1425 1452 N/A INTRINSIC
low complexity region 1482 1512 N/A INTRINSIC
low complexity region 1514 1532 N/A INTRINSIC
low complexity region 1585 1648 N/A INTRINSIC
low complexity region 1674 1705 N/A INTRINSIC
low complexity region 1721 1749 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193361
AA Change: Y1350C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141792
Gene: ENSMUSG00000052613
AA Change: Y1350C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1661 1678 N/A INTRINSIC
low complexity region 1740 1760 N/A INTRINSIC
low complexity region 1767 1780 N/A INTRINSIC
low complexity region 1784 1834 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193739
AA Change: Y1350C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142173
Gene: ENSMUSG00000052613
AA Change: Y1350C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1420 1447 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194315
AA Change: Y750C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141594
Gene: ENSMUSG00000052613
AA Change: Y750C

DomainStartEndE-ValueType
CA 43 120 2.3e-22 SMART
CA 144 222 9.3e-29 SMART
CA 246 329 2.8e-17 SMART
CA 353 439 3.3e-11 SMART
CA 460 547 1.5e-18 SMART
CA 571 655 2.3e-6 SMART
transmembrane domain 780 802 N/A INTRINSIC
low complexity region 823 850 N/A INTRINSIC
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1130 1150 N/A INTRINSIC
low complexity region 1157 1170 N/A INTRINSIC
low complexity region 1174 1224 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195531
AA Change: Y1345C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141920
Gene: ENSMUSG00000052613
AA Change: Y1345C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 715 2.3e-22 SMART
CA 739 817 9.3e-29 SMART
CA 841 924 2.8e-17 SMART
CA 948 1034 3.3e-11 SMART
CA 1055 1142 1.5e-18 SMART
CA 1166 1250 2.3e-6 SMART
transmembrane domain 1377 1399 N/A INTRINSIC
low complexity region 1415 1442 N/A INTRINSIC
low complexity region 1514 1531 N/A INTRINSIC
Meta Mutation Damage Score 0.2286 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 97% (102/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygotes for severe mutations exhibit circling, head-tossing, hyperactivity, impaired swimming and profound deafness. Mice have defects in cochlea and degeneration of hair cells, spiral ganglion cells and saccular macula. Females are poor mothers. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Transgenic(1) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,787,583 L138Q probably damaging Het
1700028P14Rik T C 19: 23,652,698 E10G unknown Het
1700029J07Rik A G 8: 45,956,460 F274S probably damaging Het
2210408I21Rik A G 13: 77,323,607 S1044G probably benign Het
4930578C19Rik T A X: 18,423,552 I224F possibly damaging Het
4931409K22Rik T C 5: 24,550,733 probably null Het
9930021J03Rik T C 19: 29,720,574 probably benign Het
Aanat A G 11: 116,596,904 H143R probably benign Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcb1a G T 5: 8,674,856 probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Alk T C 17: 71,895,935 Y1135C probably damaging Het
Atad2b C T 12: 4,965,915 T547I probably damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Clec4f T A 6: 83,652,997 N193I probably damaging Het
Col4a4 A T 1: 82,529,656 probably null Het
Cplx4 T G 18: 65,957,045 D101A possibly damaging Het
Cpne8 A T 15: 90,649,271 D50E probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Ctdp1 A G 18: 80,469,521 V9A probably benign Het
Ctnnd2 A T 15: 30,332,155 probably benign Het
Cyp7b1 C T 3: 18,097,510 A180T probably benign Het
D3Ertd254e T A 3: 36,164,786 Y319* probably null Het
Dcun1d5 C T 9: 7,203,379 probably benign Het
Dgat1 G T 15: 76,502,999 L363I possibly damaging Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dnah6 T C 6: 73,124,757 N1928S probably benign Het
Dync2h1 A T 9: 7,041,734 probably benign Het
Ednra T G 8: 77,720,020 probably benign Het
Efcab6 A T 15: 83,918,292 C845S probably benign Het
Egln1 A T 8: 124,915,696 C303S probably damaging Het
Eomes T C 9: 118,482,300 probably null Het
Epha1 A G 6: 42,363,822 V568A probably benign Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Fbxo46 T C 7: 19,135,729 V91A probably damaging Het
Fryl A T 5: 73,041,332 probably benign Het
Gab3 A C X: 75,033,418 D43E probably damaging Het
Gltpd2 T A 11: 70,519,709 probably benign Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm7353 T C 7: 3,110,570 noncoding transcript Het
Grik4 T C 9: 42,688,109 probably benign Het
Gtpbp2 G T 17: 46,165,969 A358S possibly damaging Het
Hyls1 C T 9: 35,561,232 C296Y probably damaging Het
Igf2r C T 17: 12,692,101 M1943I probably benign Het
Ireb2 T A 9: 54,896,577 N517K probably damaging Het
Itga10 A G 3: 96,653,660 S614G possibly damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif17 T C 4: 138,298,231 M948T possibly damaging Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Llph T A 10: 120,228,181 C67* probably null Het
Lrrn3 T C 12: 41,454,034 T95A probably damaging Het
Map3k12 C A 15: 102,502,178 A455S probably damaging Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Myo7b A G 18: 32,000,070 W409R probably damaging Het
Nbea A G 3: 56,009,340 M833T possibly damaging Het
Ncapg A G 5: 45,679,894 T436A probably null Het
Nkx1-2 C A 7: 132,599,313 D72Y probably null Het
Olfr1532-ps1 T A 7: 106,915,110 I304K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr815 T A 10: 129,901,882 N276I probably damaging Het
Pcnx2 A G 8: 125,886,926 probably benign Het
Pcsk1 G A 13: 75,097,977 G158D probably damaging Het
Phkb A T 8: 86,017,441 D573V probably damaging Het
Pik3r4 A G 9: 105,667,771 K150E possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Ppp4r4 C T 12: 103,600,495 A67V probably damaging Het
Prex2 A G 1: 11,181,898 T1056A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Psd T C 19: 46,313,441 E903G probably damaging Het
Psg19 T C 7: 18,794,062 E252G probably benign Het
Psg20 T A 7: 18,681,044 K306* probably null Het
Pygl T G 12: 70,194,374 probably benign Het
Rasgrf2 A G 13: 91,982,771 S724P probably damaging Het
Reck C A 4: 43,922,967 A414D probably damaging Het
Scn10a C A 9: 119,630,147 V1150L probably damaging Het
Shc2 A T 10: 79,629,917 I187N probably damaging Het
Sipa1l3 T A 7: 29,387,291 K625* probably null Het
Slc44a4 T C 17: 34,928,490 L583P possibly damaging Het
Slc5a11 G C 7: 123,258,420 R244P possibly damaging Het
Slfn8 T A 11: 83,003,581 Q744L probably benign Het
Snx2 G T 18: 53,176,416 V13L probably benign Het
Spsb1 C T 4: 149,906,415 probably null Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Svil G T 18: 5,097,494 R1659L probably damaging Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tmem9 A T 1: 136,034,188 T174S possibly damaging Het
Tnks2 T C 19: 36,890,050 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ttf2 A G 3: 100,969,549 probably benign Het
Ubr7 C A 12: 102,769,191 T303N probably damaging Het
Ushbp1 A T 8: 71,390,224 probably null Het
Vmn1r177 C A 7: 23,866,050 V134F probably benign Het
Vmn2r12 A G 5: 109,087,850 probably null Het
Vmn2r53 T G 7: 12,601,214 H173P probably benign Het
Wdr78 T C 4: 103,049,386 probably benign Het
Yars A T 4: 129,197,155 M119L probably damaging Het
Zcrb1 A T 15: 93,397,157 probably benign Het
Zfp319 C A 8: 95,329,622 probably benign Het
Zfp783 C G 6: 47,943,386 noncoding transcript Het
Zfyve26 A G 12: 79,273,598 I1024T possibly damaging Het
Other mutations in Pcdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pcdh15 APN 10 74185345 nonsense probably null
IGL00432:Pcdh15 APN 10 74291082 splice site probably benign
IGL00533:Pcdh15 APN 10 74502720 missense probably damaging 1.00
IGL00596:Pcdh15 APN 10 74630744 missense probably benign 0.00
IGL00930:Pcdh15 APN 10 74630698 missense probably benign 0.08
IGL00970:Pcdh15 APN 10 74379340 missense probably damaging 1.00
IGL01087:Pcdh15 APN 10 74342632 missense possibly damaging 0.90
IGL01763:Pcdh15 APN 10 74210461 missense probably benign 0.09
IGL01787:Pcdh15 APN 10 74450283 missense probably benign 0.25
IGL02070:Pcdh15 APN 10 74630868 missense probably benign 0.00
IGL02234:Pcdh15 APN 10 74631862 missense probably benign 0.02
IGL02268:Pcdh15 APN 10 74342672 missense probably damaging 1.00
IGL02280:Pcdh15 APN 10 74222463 missense probably damaging 1.00
IGL02363:Pcdh15 APN 10 74317086 missense probably damaging 0.98
IGL02420:Pcdh15 APN 10 74303106 missense probably damaging 0.98
IGL02749:Pcdh15 APN 10 74631068 missense probably benign 0.00
IGL02939:Pcdh15 APN 10 74504816 splice site probably benign
IGL02970:Pcdh15 APN 10 74290962 splice site probably benign
IGL03010:Pcdh15 APN 10 74385945 missense probably damaging 1.00
IGL03061:Pcdh15 APN 10 74317011 missense probably damaging 0.97
IGL03095:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03149:Pcdh15 APN 10 74630695 missense probably damaging 1.00
IGL03187:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03279:Pcdh15 APN 10 74317072 missense probably damaging 1.00
IGL03392:Pcdh15 APN 10 74624272 missense probably damaging 1.00
loop UTSW 10 74185378 missense probably damaging 1.00
mcduck UTSW 10 74626844 critical splice donor site probably null
spaz UTSW 10 74210425 missense probably damaging 1.00
sphere UTSW 10 74624284 missense probably damaging 1.00
squirm UTSW 10 large deletion
Tortilla UTSW 10 74379417 splice site probably null
1mM(1):Pcdh15 UTSW 10 74626137 intron probably benign
R0038:Pcdh15 UTSW 10 74643440 missense possibly damaging 0.95
R0103:Pcdh15 UTSW 10 74210425 missense probably damaging 1.00
R0110:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0111:Pcdh15 UTSW 10 74626819 nonsense probably null
R0119:Pcdh15 UTSW 10 74170575 missense probably damaging 1.00
R0131:Pcdh15 UTSW 10 74170608 missense probably null 1.00
R0445:Pcdh15 UTSW 10 74342549 missense probably damaging 1.00
R0464:Pcdh15 UTSW 10 74626844 critical splice donor site probably null
R0503:Pcdh15 UTSW 10 74210385 missense probably damaging 1.00
R0507:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0510:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0742:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0790:Pcdh15 UTSW 10 74631053 missense probably benign 0.01
R0829:Pcdh15 UTSW 10 74502766 missense probably damaging 1.00
R0839:Pcdh15 UTSW 10 74626782 missense probably null 1.00
R0882:Pcdh15 UTSW 10 74342656 missense probably damaging 1.00
R0944:Pcdh15 UTSW 10 74210470 missense probably damaging 0.99
R1081:Pcdh15 UTSW 10 74450313 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1484:Pcdh15 UTSW 10 74291001 missense probably damaging 1.00
R1521:Pcdh15 UTSW 10 74594191 missense probably damaging 1.00
R1694:Pcdh15 UTSW 10 74594163 missense probably damaging 1.00
R1795:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R2021:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2022:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2023:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2076:Pcdh15 UTSW 10 74342647 missense probably damaging 1.00
R2199:Pcdh15 UTSW 10 74170509 missense probably damaging 1.00
R2510:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R2511:Pcdh15 UTSW 10 74645996 missense possibly damaging 0.94
R3418:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3419:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3433:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R3619:Pcdh15 UTSW 10 74643395 missense probably damaging 0.99
R3723:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3724:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3778:Pcdh15 UTSW 10 73947151 splice site probably null
R3851:Pcdh15 UTSW 10 74631686 missense probably damaging 0.97
R4175:Pcdh15 UTSW 10 74631997 intron probably benign
R4261:Pcdh15 UTSW 10 74645680 missense probably damaging 1.00
R4385:Pcdh15 UTSW 10 74550490 missense probably damaging 1.00
R4585:Pcdh15 UTSW 10 74624284 missense probably damaging 1.00
R4602:Pcdh15 UTSW 10 74594214 missense probably damaging 1.00
R4639:Pcdh15 UTSW 10 74643607 missense probably benign 0.00
R4703:Pcdh15 UTSW 10 74450163 missense probably damaging 1.00
R4819:Pcdh15 UTSW 10 74324389 missense probably damaging 1.00
R4906:Pcdh15 UTSW 10 74504793 nonsense probably null
R4961:Pcdh15 UTSW 10 74379417 splice site probably null
R5018:Pcdh15 UTSW 10 74643775 missense possibly damaging 0.68
R5125:Pcdh15 UTSW 10 74584080 missense probably damaging 0.98
R5225:Pcdh15 UTSW 10 74303154 missense probably damaging 1.00
R5259:Pcdh15 UTSW 10 74396372 missense possibly damaging 0.67
R5279:Pcdh15 UTSW 10 74594183 missense probably damaging 1.00
R5395:Pcdh15 UTSW 10 74185287 missense probably damaging 1.00
R5458:Pcdh15 UTSW 10 74504779 missense probably damaging 1.00
R5617:Pcdh15 UTSW 10 74635672 intron probably benign
R5665:Pcdh15 UTSW 10 74626788 missense probably damaging 1.00
R5770:Pcdh15 UTSW 10 74185345 nonsense probably null
R5805:Pcdh15 UTSW 10 74230259 missense probably damaging 1.00
R5914:Pcdh15 UTSW 10 74630936 missense probably benign 0.42
R5988:Pcdh15 UTSW 10 74379357 missense probably benign 0.05
R6133:Pcdh15 UTSW 10 74645973 unclassified probably null
R6189:Pcdh15 UTSW 10 74342651 missense probably null 1.00
R6414:Pcdh15 UTSW 10 74185426 missense probably damaging 1.00
R6536:Pcdh15 UTSW 10 74631389 missense probably damaging 1.00
R6612:Pcdh15 UTSW 10 74185378 missense probably damaging 1.00
R6711:Pcdh15 UTSW 10 74642387 missense possibly damaging 0.83
R6793:Pcdh15 UTSW 10 74631139 missense probably damaging 1.00
R6841:Pcdh15 UTSW 10 74450220 missense probably damaging 1.00
R6845:Pcdh15 UTSW 10 74630633 missense probably benign
R6915:Pcdh15 UTSW 10 74643809 missense probably benign 0.16
R6954:Pcdh15 UTSW 10 74645989 missense possibly damaging 0.92
R6970:Pcdh15 UTSW 10 74502687 missense probably damaging 0.98
R7018:Pcdh15 UTSW 10 74466354 missense probably damaging 1.00
R7064:Pcdh15 UTSW 10 74630614 missense possibly damaging 0.67
R7079:Pcdh15 UTSW 10 74317125 missense probably benign 0.21
R7172:Pcdh15 UTSW 10 74502765 missense probably damaging 1.00
R7220:Pcdh15 UTSW 10 74342609 missense possibly damaging 0.64
R7237:Pcdh15 UTSW 10 74584191 missense possibly damaging 0.88
R7266:Pcdh15 UTSW 10 74379390 nonsense probably null
R7276:Pcdh15 UTSW 10 74324392 missense probably benign 0.25
R7359:Pcdh15 UTSW 10 74584216 missense probably damaging 0.99
R7396:Pcdh15 UTSW 10 74630690 missense probably benign 0.17
R7421:Pcdh15 UTSW 10 74454065 missense possibly damaging 0.90
R7424:Pcdh15 UTSW 10 74506485 missense probably benign 0.09
R7463:Pcdh15 UTSW 10 74631770 missense possibly damaging 0.66
R7469:Pcdh15 UTSW 10 74645980 missense probably benign
R7512:Pcdh15 UTSW 10 74641382 missense possibly damaging 0.81
R7767:Pcdh15 UTSW 10 74486256 missense probably benign 0.07
R7830:Pcdh15 UTSW 10 74385901 missense probably damaging 1.00
R7890:Pcdh15 UTSW 10 74642314 missense probably damaging 1.00
R7897:Pcdh15 UTSW 10 74453995 missense probably damaging 1.00
R7908:Pcdh15 UTSW 10 74643582 missense probably benign 0.04
R7973:Pcdh15 UTSW 10 74642314 missense probably damaging 1.00
R7980:Pcdh15 UTSW 10 74453995 missense probably damaging 1.00
R7989:Pcdh15 UTSW 10 74643582 missense probably benign 0.04
RF020:Pcdh15 UTSW 10 74185410 missense probably damaging 1.00
Z1176:Pcdh15 UTSW 10 74630701 missense probably benign 0.00
Z1177:Pcdh15 UTSW 10 74504800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTACTTGCTTCCCAGGTCTCAA -3'
(R):5'- CCAGCAACTGCATACTCACTGTCG -3'

Sequencing Primer
(F):5'- atttacattccagccattgcc -3'
(R):5'- GTCGGTAGCTTACTAAGACGACC -3'
Posted On2013-11-08