Incidental Mutation 'R0894:Atad2b'
ID 83691
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission 039057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0894 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4965915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 547 (T547I)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
AlphaFold E9Q166
Predicted Effect probably damaging
Transcript: ENSMUST00000045664
AA Change: T547I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: T547I

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Meta Mutation Damage Score 0.9451 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 97% (102/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,787,583 L138Q probably damaging Het
1700028P14Rik T C 19: 23,652,698 E10G unknown Het
1700029J07Rik A G 8: 45,956,460 F274S probably damaging Het
2210408I21Rik A G 13: 77,323,607 S1044G probably benign Het
4930578C19Rik T A X: 18,423,552 I224F possibly damaging Het
4931409K22Rik T C 5: 24,550,733 probably null Het
9930021J03Rik T C 19: 29,720,574 probably benign Het
Aanat A G 11: 116,596,904 H143R probably benign Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcb1a G T 5: 8,674,856 probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Alk T C 17: 71,895,935 Y1135C probably damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Clec4f T A 6: 83,652,997 N193I probably damaging Het
Col4a4 A T 1: 82,529,656 probably null Het
Cplx4 T G 18: 65,957,045 D101A possibly damaging Het
Cpne8 A T 15: 90,649,271 D50E probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Ctdp1 A G 18: 80,469,521 V9A probably benign Het
Ctnnd2 A T 15: 30,332,155 probably benign Het
Cyp7b1 C T 3: 18,097,510 A180T probably benign Het
D3Ertd254e T A 3: 36,164,786 Y319* probably null Het
Dcun1d5 C T 9: 7,203,379 probably benign Het
Dgat1 G T 15: 76,502,999 L363I possibly damaging Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dnah6 T C 6: 73,124,757 N1928S probably benign Het
Dync2h1 A T 9: 7,041,734 probably benign Het
Ednra T G 8: 77,720,020 probably benign Het
Efcab6 A T 15: 83,918,292 C845S probably benign Het
Egln1 A T 8: 124,915,696 C303S probably damaging Het
Eomes T C 9: 118,482,300 probably null Het
Epha1 A G 6: 42,363,822 V568A probably benign Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Fbxo46 T C 7: 19,135,729 V91A probably damaging Het
Fryl A T 5: 73,041,332 probably benign Het
Gab3 A C X: 75,033,418 D43E probably damaging Het
Gltpd2 T A 11: 70,519,709 probably benign Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm7353 T C 7: 3,110,570 noncoding transcript Het
Grik4 T C 9: 42,688,109 probably benign Het
Gtpbp2 G T 17: 46,165,969 A358S possibly damaging Het
Hyls1 C T 9: 35,561,232 C296Y probably damaging Het
Igf2r C T 17: 12,692,101 M1943I probably benign Het
Ireb2 T A 9: 54,896,577 N517K probably damaging Het
Itga10 A G 3: 96,653,660 S614G possibly damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif17 T C 4: 138,298,231 M948T possibly damaging Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Llph T A 10: 120,228,181 C67* probably null Het
Lrrn3 T C 12: 41,454,034 T95A probably damaging Het
Map3k12 C A 15: 102,502,178 A455S probably damaging Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Myo7b A G 18: 32,000,070 W409R probably damaging Het
Nbea A G 3: 56,009,340 M833T possibly damaging Het
Ncapg A G 5: 45,679,894 T436A probably null Het
Nkx1-2 C A 7: 132,599,313 D72Y probably null Het
Olfr1532-ps1 T A 7: 106,915,110 I304K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr815 T A 10: 129,901,882 N276I probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcnx2 A G 8: 125,886,926 probably benign Het
Pcsk1 G A 13: 75,097,977 G158D probably damaging Het
Phkb A T 8: 86,017,441 D573V probably damaging Het
Pik3r4 A G 9: 105,667,771 K150E possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Ppp4r4 C T 12: 103,600,495 A67V probably damaging Het
Prex2 A G 1: 11,181,898 T1056A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Psd T C 19: 46,313,441 E903G probably damaging Het
Psg19 T C 7: 18,794,062 E252G probably benign Het
Psg20 T A 7: 18,681,044 K306* probably null Het
Pygl T G 12: 70,194,374 probably benign Het
Rasgrf2 A G 13: 91,982,771 S724P probably damaging Het
Reck C A 4: 43,922,967 A414D probably damaging Het
Scn10a C A 9: 119,630,147 V1150L probably damaging Het
Shc2 A T 10: 79,629,917 I187N probably damaging Het
Sipa1l3 T A 7: 29,387,291 K625* probably null Het
Slc44a4 T C 17: 34,928,490 L583P possibly damaging Het
Slc5a11 G C 7: 123,258,420 R244P possibly damaging Het
Slfn8 T A 11: 83,003,581 Q744L probably benign Het
Snx2 G T 18: 53,176,416 V13L probably benign Het
Spsb1 C T 4: 149,906,415 probably null Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Svil G T 18: 5,097,494 R1659L probably damaging Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tmem9 A T 1: 136,034,188 T174S possibly damaging Het
Tnks2 T C 19: 36,890,050 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ttf2 A G 3: 100,969,549 probably benign Het
Ubr7 C A 12: 102,769,191 T303N probably damaging Het
Ushbp1 A T 8: 71,390,224 probably null Het
Vmn1r177 C A 7: 23,866,050 V134F probably benign Het
Vmn2r12 A G 5: 109,087,850 probably null Het
Vmn2r53 T G 7: 12,601,214 H173P probably benign Het
Wdr78 T C 4: 103,049,386 probably benign Het
Yars A T 4: 129,197,155 M119L probably damaging Het
Zcrb1 A T 15: 93,397,157 probably benign Het
Zfp319 C A 8: 95,329,622 probably benign Het
Zfp783 C G 6: 47,943,386 noncoding transcript Het
Zfyve26 A G 12: 79,273,598 I1024T possibly damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACAACACCAAGATTGCTCTCTGC -3'
(R):5'- TCCTTCCTGCAAAGACATTGGCAC -3'

Sequencing Primer
(F):5'- GCTCTCTGCTAACAAATAGAGTACTG -3'
(R):5'- agaaagcaaagtgtggcaag -3'
Posted On 2013-11-08