Incidental Mutation 'R0894:Atad2b'
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene NameATPase family, AAA domain containing 2B
SynonymsD530031C13Rik, 1110014E10Rik
MMRRC Submission 039057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0894 (G1)
Quality Score225
Status Validated
Chromosomal Location4917353-5047394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4965915 bp
Amino Acid Change Threonine to Isoleucine at position 547 (T547I)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
Predicted Effect probably damaging
Transcript: ENSMUST00000045664
AA Change: T547I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: T547I

low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Meta Mutation Damage Score 0.9451 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 97% (102/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,787,583 L138Q probably damaging Het
1700028P14Rik T C 19: 23,652,698 E10G unknown Het
1700029J07Rik A G 8: 45,956,460 F274S probably damaging Het
2210408I21Rik A G 13: 77,323,607 S1044G probably benign Het
4930578C19Rik T A X: 18,423,552 I224F possibly damaging Het
4931409K22Rik T C 5: 24,550,733 probably null Het
9930021J03Rik T C 19: 29,720,574 probably benign Het
Aanat A G 11: 116,596,904 H143R probably benign Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcb1a G T 5: 8,674,856 probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Alk T C 17: 71,895,935 Y1135C probably damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Clec4f T A 6: 83,652,997 N193I probably damaging Het
Col4a4 A T 1: 82,529,656 probably null Het
Cplx4 T G 18: 65,957,045 D101A possibly damaging Het
Cpne8 A T 15: 90,649,271 D50E probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Ctdp1 A G 18: 80,469,521 V9A probably benign Het
Ctnnd2 A T 15: 30,332,155 probably benign Het
Cyp7b1 C T 3: 18,097,510 A180T probably benign Het
D3Ertd254e T A 3: 36,164,786 Y319* probably null Het
Dcun1d5 C T 9: 7,203,379 probably benign Het
Dgat1 G T 15: 76,502,999 L363I possibly damaging Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dnah6 T C 6: 73,124,757 N1928S probably benign Het
Dync2h1 A T 9: 7,041,734 probably benign Het
Ednra T G 8: 77,720,020 probably benign Het
Efcab6 A T 15: 83,918,292 C845S probably benign Het
Egln1 A T 8: 124,915,696 C303S probably damaging Het
Eomes T C 9: 118,482,300 probably null Het
Epha1 A G 6: 42,363,822 V568A probably benign Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Fbxo46 T C 7: 19,135,729 V91A probably damaging Het
Fryl A T 5: 73,041,332 probably benign Het
Gab3 A C X: 75,033,418 D43E probably damaging Het
Gltpd2 T A 11: 70,519,709 probably benign Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm7353 T C 7: 3,110,570 noncoding transcript Het
Grik4 T C 9: 42,688,109 probably benign Het
Gtpbp2 G T 17: 46,165,969 A358S possibly damaging Het
Hyls1 C T 9: 35,561,232 C296Y probably damaging Het
Igf2r C T 17: 12,692,101 M1943I probably benign Het
Ireb2 T A 9: 54,896,577 N517K probably damaging Het
Itga10 A G 3: 96,653,660 S614G possibly damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif17 T C 4: 138,298,231 M948T possibly damaging Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Llph T A 10: 120,228,181 C67* probably null Het
Lrrn3 T C 12: 41,454,034 T95A probably damaging Het
Map3k12 C A 15: 102,502,178 A455S probably damaging Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Myo7b A G 18: 32,000,070 W409R probably damaging Het
Nbea A G 3: 56,009,340 M833T possibly damaging Het
Ncapg A G 5: 45,679,894 T436A probably null Het
Nkx1-2 C A 7: 132,599,313 D72Y probably null Het
Olfr1532-ps1 T A 7: 106,915,110 I304K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr815 T A 10: 129,901,882 N276I probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcnx2 A G 8: 125,886,926 probably benign Het
Pcsk1 G A 13: 75,097,977 G158D probably damaging Het
Phkb A T 8: 86,017,441 D573V probably damaging Het
Pik3r4 A G 9: 105,667,771 K150E possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Ppp4r4 C T 12: 103,600,495 A67V probably damaging Het
Prex2 A G 1: 11,181,898 T1056A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Psd T C 19: 46,313,441 E903G probably damaging Het
Psg19 T C 7: 18,794,062 E252G probably benign Het
Psg20 T A 7: 18,681,044 K306* probably null Het
Pygl T G 12: 70,194,374 probably benign Het
Rasgrf2 A G 13: 91,982,771 S724P probably damaging Het
Reck C A 4: 43,922,967 A414D probably damaging Het
Scn10a C A 9: 119,630,147 V1150L probably damaging Het
Shc2 A T 10: 79,629,917 I187N probably damaging Het
Sipa1l3 T A 7: 29,387,291 K625* probably null Het
Slc44a4 T C 17: 34,928,490 L583P possibly damaging Het
Slc5a11 G C 7: 123,258,420 R244P possibly damaging Het
Slfn8 T A 11: 83,003,581 Q744L probably benign Het
Snx2 G T 18: 53,176,416 V13L probably benign Het
Spsb1 C T 4: 149,906,415 probably null Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Svil G T 18: 5,097,494 R1659L probably damaging Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tmem9 A T 1: 136,034,188 T174S possibly damaging Het
Tnks2 T C 19: 36,890,050 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ttf2 A G 3: 100,969,549 probably benign Het
Ubr7 C A 12: 102,769,191 T303N probably damaging Het
Ushbp1 A T 8: 71,390,224 probably null Het
Vmn1r177 C A 7: 23,866,050 V134F probably benign Het
Vmn2r12 A G 5: 109,087,850 probably null Het
Vmn2r53 T G 7: 12,601,214 H173P probably benign Het
Wdr78 T C 4: 103,049,386 probably benign Het
Yars A T 4: 129,197,155 M119L probably damaging Het
Zcrb1 A T 15: 93,397,157 probably benign Het
Zfp319 C A 8: 95,329,622 probably benign Het
Zfp783 C G 6: 47,943,386 noncoding transcript Het
Zfyve26 A G 12: 79,273,598 I1024T possibly damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agaaagcaaagtgtggcaag -3'
Posted On2013-11-08