Incidental Mutation 'R0894:Ppp4r4'
ID83697
Institutional Source Beutler Lab
Gene Symbol Ppp4r4
Ensembl Gene ENSMUSG00000021209
Gene Nameprotein phosphatase 4, regulatory subunit 4
Synonyms8430415E04Rik
MMRRC Submission 039057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R0894 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103532283-103613831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103600495 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 67 (A67V)
Ref Sequence ENSEMBL: ENSMUSP00000139815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190151]
Predicted Effect probably benign
Transcript: ENSMUST00000021631
AA Change: A668V

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209
AA Change: A668V

DomainStartEndE-ValueType
SCOP:d1gw5a_ 55 577 6e-27 SMART
PDB:3FGA|A 178 666 8e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187155
AA Change: A559V

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209
AA Change: A559V

DomainStartEndE-ValueType
Pfam:HEAT 145 175 2.8e-3 PFAM
low complexity region 484 495 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189871
AA Change: A668V

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209
AA Change: A668V

DomainStartEndE-ValueType
SCOP:d1gw5a_ 95 577 7e-26 SMART
PDB:1B3U|B 178 666 2e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190151
AA Change: A67V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139815
Gene: ENSMUSG00000021209
AA Change: A67V

DomainStartEndE-ValueType
low complexity region 99 114 N/A INTRINSIC
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 97% (102/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,787,583 L138Q probably damaging Het
1700028P14Rik T C 19: 23,652,698 E10G unknown Het
1700029J07Rik A G 8: 45,956,460 F274S probably damaging Het
2210408I21Rik A G 13: 77,323,607 S1044G probably benign Het
4930578C19Rik T A X: 18,423,552 I224F possibly damaging Het
4931409K22Rik T C 5: 24,550,733 probably null Het
9930021J03Rik T C 19: 29,720,574 probably benign Het
Aanat A G 11: 116,596,904 H143R probably benign Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcb1a G T 5: 8,674,856 probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Alk T C 17: 71,895,935 Y1135C probably damaging Het
Atad2b C T 12: 4,965,915 T547I probably damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Clec4f T A 6: 83,652,997 N193I probably damaging Het
Col4a4 A T 1: 82,529,656 probably null Het
Cplx4 T G 18: 65,957,045 D101A possibly damaging Het
Cpne8 A T 15: 90,649,271 D50E probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Ctdp1 A G 18: 80,469,521 V9A probably benign Het
Ctnnd2 A T 15: 30,332,155 probably benign Het
Cyp7b1 C T 3: 18,097,510 A180T probably benign Het
D3Ertd254e T A 3: 36,164,786 Y319* probably null Het
Dcun1d5 C T 9: 7,203,379 probably benign Het
Dgat1 G T 15: 76,502,999 L363I possibly damaging Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dnah6 T C 6: 73,124,757 N1928S probably benign Het
Dync2h1 A T 9: 7,041,734 probably benign Het
Ednra T G 8: 77,720,020 probably benign Het
Efcab6 A T 15: 83,918,292 C845S probably benign Het
Egln1 A T 8: 124,915,696 C303S probably damaging Het
Eomes T C 9: 118,482,300 probably null Het
Epha1 A G 6: 42,363,822 V568A probably benign Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Fbxo46 T C 7: 19,135,729 V91A probably damaging Het
Fryl A T 5: 73,041,332 probably benign Het
Gab3 A C X: 75,033,418 D43E probably damaging Het
Gltpd2 T A 11: 70,519,709 probably benign Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm7353 T C 7: 3,110,570 noncoding transcript Het
Grik4 T C 9: 42,688,109 probably benign Het
Gtpbp2 G T 17: 46,165,969 A358S possibly damaging Het
Hyls1 C T 9: 35,561,232 C296Y probably damaging Het
Igf2r C T 17: 12,692,101 M1943I probably benign Het
Ireb2 T A 9: 54,896,577 N517K probably damaging Het
Itga10 A G 3: 96,653,660 S614G possibly damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif17 T C 4: 138,298,231 M948T possibly damaging Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Llph T A 10: 120,228,181 C67* probably null Het
Lrrn3 T C 12: 41,454,034 T95A probably damaging Het
Map3k12 C A 15: 102,502,178 A455S probably damaging Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Myo7b A G 18: 32,000,070 W409R probably damaging Het
Nbea A G 3: 56,009,340 M833T possibly damaging Het
Ncapg A G 5: 45,679,894 T436A probably null Het
Nkx1-2 C A 7: 132,599,313 D72Y probably null Het
Olfr1532-ps1 T A 7: 106,915,110 I304K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr815 T A 10: 129,901,882 N276I probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcnx2 A G 8: 125,886,926 probably benign Het
Pcsk1 G A 13: 75,097,977 G158D probably damaging Het
Phkb A T 8: 86,017,441 D573V probably damaging Het
Pik3r4 A G 9: 105,667,771 K150E possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prex2 A G 1: 11,181,898 T1056A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Psd T C 19: 46,313,441 E903G probably damaging Het
Psg19 T C 7: 18,794,062 E252G probably benign Het
Psg20 T A 7: 18,681,044 K306* probably null Het
Pygl T G 12: 70,194,374 probably benign Het
Rasgrf2 A G 13: 91,982,771 S724P probably damaging Het
Reck C A 4: 43,922,967 A414D probably damaging Het
Scn10a C A 9: 119,630,147 V1150L probably damaging Het
Shc2 A T 10: 79,629,917 I187N probably damaging Het
Sipa1l3 T A 7: 29,387,291 K625* probably null Het
Slc44a4 T C 17: 34,928,490 L583P possibly damaging Het
Slc5a11 G C 7: 123,258,420 R244P possibly damaging Het
Slfn8 T A 11: 83,003,581 Q744L probably benign Het
Snx2 G T 18: 53,176,416 V13L probably benign Het
Spsb1 C T 4: 149,906,415 probably null Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Svil G T 18: 5,097,494 R1659L probably damaging Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tmem9 A T 1: 136,034,188 T174S possibly damaging Het
Tnks2 T C 19: 36,890,050 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ttf2 A G 3: 100,969,549 probably benign Het
Ubr7 C A 12: 102,769,191 T303N probably damaging Het
Ushbp1 A T 8: 71,390,224 probably null Het
Vmn1r177 C A 7: 23,866,050 V134F probably benign Het
Vmn2r12 A G 5: 109,087,850 probably null Het
Vmn2r53 T G 7: 12,601,214 H173P probably benign Het
Wdr78 T C 4: 103,049,386 probably benign Het
Yars A T 4: 129,197,155 M119L probably damaging Het
Zcrb1 A T 15: 93,397,157 probably benign Het
Zfp319 C A 8: 95,329,622 probably benign Het
Zfp783 C G 6: 47,943,386 noncoding transcript Het
Zfyve26 A G 12: 79,273,598 I1024T possibly damaging Het
Other mutations in Ppp4r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Ppp4r4 APN 12 103579076 missense probably benign
IGL01388:Ppp4r4 APN 12 103576849 missense probably damaging 1.00
IGL01662:Ppp4r4 APN 12 103602966 missense possibly damaging 0.55
IGL01768:Ppp4r4 APN 12 103581405 missense probably benign 0.12
IGL01894:Ppp4r4 APN 12 103593138 missense probably damaging 1.00
IGL01921:Ppp4r4 APN 12 103576310 start codon destroyed probably null 0.01
IGL01960:Ppp4r4 APN 12 103581494 splice site probably benign
IGL02084:Ppp4r4 APN 12 103600398 missense possibly damaging 0.93
IGL02287:Ppp4r4 APN 12 103587488 missense probably benign 0.01
IGL02315:Ppp4r4 APN 12 103600361 splice site probably benign
IGL03137:Ppp4r4 APN 12 103581384 missense probably damaging 1.00
IGL03170:Ppp4r4 APN 12 103590774 intron probably benign
cataract UTSW 12 103612815 nonsense probably null
downfall UTSW 12 103593098 missense probably benign 0.00
R0114:Ppp4r4 UTSW 12 103576374 missense probably benign 0.00
R0390:Ppp4r4 UTSW 12 103601360 splice site probably benign
R0403:Ppp4r4 UTSW 12 103584102 missense probably benign
R0548:Ppp4r4 UTSW 12 103612815 nonsense probably null
R0601:Ppp4r4 UTSW 12 103600520 splice site probably benign
R1127:Ppp4r4 UTSW 12 103579068 missense probably damaging 1.00
R1177:Ppp4r4 UTSW 12 103576323 missense possibly damaging 0.82
R1378:Ppp4r4 UTSW 12 103581492 splice site probably benign
R1442:Ppp4r4 UTSW 12 103598245 missense probably damaging 0.97
R1497:Ppp4r4 UTSW 12 103606945 missense probably benign 0.07
R1651:Ppp4r4 UTSW 12 103584072 missense probably benign 0.01
R1797:Ppp4r4 UTSW 12 103598151 missense possibly damaging 0.95
R1880:Ppp4r4 UTSW 12 103605035 missense possibly damaging 0.62
R2008:Ppp4r4 UTSW 12 103585757 missense probably damaging 1.00
R2038:Ppp4r4 UTSW 12 103576280 critical splice acceptor site probably null
R2404:Ppp4r4 UTSW 12 103581490 splice site probably null
R2696:Ppp4r4 UTSW 12 103581394 missense possibly damaging 0.77
R2849:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R2965:Ppp4r4 UTSW 12 103612821 missense probably damaging 1.00
R3030:Ppp4r4 UTSW 12 103606956 missense probably benign
R3805:Ppp4r4 UTSW 12 103600366 missense probably damaging 0.99
R3862:Ppp4r4 UTSW 12 103596421 nonsense probably null
R4194:Ppp4r4 UTSW 12 103558445 missense probably damaging 1.00
R4320:Ppp4r4 UTSW 12 103598243 missense probably damaging 1.00
R4558:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R4783:Ppp4r4 UTSW 12 103590858 critical splice donor site probably null
R4866:Ppp4r4 UTSW 12 103600447 missense possibly damaging 0.92
R4903:Ppp4r4 UTSW 12 103590771 splice site probably null
R5309:Ppp4r4 UTSW 12 103606888 splice site probably null
R5312:Ppp4r4 UTSW 12 103606888 splice site probably null
R5381:Ppp4r4 UTSW 12 103593098 missense probably benign 0.00
R5383:Ppp4r4 UTSW 12 103584168 missense probably benign 0.14
R5447:Ppp4r4 UTSW 12 103584151 missense possibly damaging 0.67
R5942:Ppp4r4 UTSW 12 103587447 missense possibly damaging 0.92
R6339:Ppp4r4 UTSW 12 103604969 nonsense probably null
R6386:Ppp4r4 UTSW 12 103593105 missense probably damaging 1.00
R6712:Ppp4r4 UTSW 12 103596443 missense probably damaging 1.00
R6755:Ppp4r4 UTSW 12 103585737 missense probably damaging 1.00
R6868:Ppp4r4 UTSW 12 103590852 missense probably damaging 1.00
R6879:Ppp4r4 UTSW 12 103551920 intron probably null
R7355:Ppp4r4 UTSW 12 103604582 nonsense probably null
R7397:Ppp4r4 UTSW 12 103612806 critical splice acceptor site probably null
R7447:Ppp4r4 UTSW 12 103585726 missense possibly damaging 0.46
R7576:Ppp4r4 UTSW 12 103596449 missense probably damaging 0.97
R7653:Ppp4r4 UTSW 12 103584145 missense probably damaging 0.98
R7683:Ppp4r4 UTSW 12 103587105 nonsense probably null
R7748:Ppp4r4 UTSW 12 103605061 critical splice donor site probably null
R7831:Ppp4r4 UTSW 12 103590821 missense possibly damaging 0.76
R7833:Ppp4r4 UTSW 12 103598148 missense probably benign 0.03
R7914:Ppp4r4 UTSW 12 103590821 missense possibly damaging 0.76
R7916:Ppp4r4 UTSW 12 103598148 missense probably benign 0.03
X0025:Ppp4r4 UTSW 12 103600480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTTATGCAGACCAACGAATGCC -3'
(R):5'- GATCTCCCTTTAGAAATGCCCGTCC -3'

Sequencing Primer
(F):5'- agaccaacgaatgccttataaac -3'
(R):5'- CTTTCCCAAGGAGCAGCAG -3'
Posted On2013-11-08