Incidental Mutation 'R0894:Csmd3'
ID83707
Institutional Source Beutler Lab
Gene Symbol Csmd3
Ensembl Gene ENSMUSG00000022311
Gene NameCUB and Sushi multiple domains 3
Synonyms4930500N14Rik
MMRRC Submission 039057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0894 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location47580637-48792063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47857920 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1542 (D1542E)
Ref Sequence ENSEMBL: ENSMUSP00000124775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100670] [ENSMUST00000160658] [ENSMUST00000162830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100670
AA Change: D1542E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098235
Gene: ENSMUSG00000022311
AA Change: D1542E

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160658
AA Change: D1438E

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124753
Gene: ENSMUSG00000022311
AA Change: D1438E

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
CCP 382 439 6.9e-14 SMART
CUB 444 555 9.22e-24 SMART
CCP 560 613 1.29e-13 SMART
CUB 617 725 6.87e-32 SMART
CCP 730 787 5.19e-9 SMART
CUB 791 899 3.23e-37 SMART
CCP 906 959 1.82e-13 SMART
CUB 963 1073 4.87e-23 SMART
CCP 1078 1133 1.82e-13 SMART
CUB 1137 1245 5.02e-25 SMART
CCP 1250 1306 2.5e-11 SMART
CUB 1310 1419 6.27e-26 SMART
CCP 1424 1480 4.41e-12 SMART
CUB 1484 1592 5.37e-34 SMART
CCP 1597 1654 1.18e-12 SMART
CUB 1658 1766 2.27e-23 SMART
CCP 1774 1831 1.84e-9 SMART
CUB 1835 1943 1.8e-35 SMART
CCP 1948 2003 4.48e-13 SMART
CUB 2007 2115 3.95e-32 SMART
CCP 2120 2175 4.02e-15 SMART
CUB 2179 2286 1.74e-33 SMART
CCP 2291 2348 5.82e-12 SMART
CUB 2353 2463 5.3e-24 SMART
CCP 2465 2523 2.11e-9 SMART
CCP 2528 2585 8.23e-12 SMART
CCP 2590 2643 1.14e-14 SMART
CCP 2648 2701 4.76e-17 SMART
CCP 2706 2759 1.85e-14 SMART
CCP 2764 2821 9.9e-15 SMART
CCP 2826 2879 1.79e-12 SMART
CCP 2887 2940 1.72e-14 SMART
CCP 2945 2999 3.17e-13 SMART
CCP 3004 3059 1.25e-11 SMART
CCP 3064 3117 1.25e-11 SMART
CCP 3122 3175 8.23e-12 SMART
CCP 3183 3237 5.6e-14 SMART
CCP 3242 3297 1.89e-11 SMART
transmembrane domain 3461 3483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161653
AA Change: D701E
SMART Domains Protein: ENSMUSP00000124195
Gene: ENSMUSG00000022311
AA Change: D701E

DomainStartEndE-ValueType
CCP 1 51 6.59e-1 SMART
CUB 55 163 3.23e-37 SMART
CCP 170 223 1.82e-13 SMART
CUB 227 337 4.87e-23 SMART
CCP 342 397 1.82e-13 SMART
CUB 401 509 5.02e-25 SMART
CCP 514 570 2.5e-11 SMART
CUB 574 683 6.27e-26 SMART
CCP 688 744 4.41e-12 SMART
CUB 748 856 5.37e-34 SMART
CCP 861 918 1.18e-12 SMART
Pfam:CUB 922 964 9.7e-8 PFAM
CCP 968 1025 1.84e-9 SMART
CUB 1029 1137 1.8e-35 SMART
CCP 1142 1197 4.48e-13 SMART
CUB 1201 1309 3.95e-32 SMART
CCP 1314 1369 4.02e-15 SMART
CUB 1373 1480 1.74e-33 SMART
CCP 1485 1542 5.82e-12 SMART
CUB 1547 1657 5.3e-24 SMART
CCP 1659 1717 2.11e-9 SMART
CCP 1722 1779 8.23e-12 SMART
CCP 1784 1844 8.56e-10 SMART
CCP 1849 1902 1.14e-14 SMART
CCP 1907 1960 4.76e-17 SMART
CCP 1965 2018 1.85e-14 SMART
CCP 2023 2080 9.9e-15 SMART
CCP 2085 2138 1.79e-12 SMART
CCP 2146 2199 1.72e-14 SMART
CCP 2204 2258 3.17e-13 SMART
CCP 2263 2318 1.25e-11 SMART
CCP 2323 2376 1.25e-11 SMART
CCP 2381 2434 8.23e-12 SMART
CCP 2442 2496 5.6e-14 SMART
CCP 2501 2556 1.89e-11 SMART
transmembrane domain 2720 2742 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162830
AA Change: D1542E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124775
Gene: ENSMUSG00000022311
AA Change: D1542E

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 97% (102/105)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,787,583 L138Q probably damaging Het
1700028P14Rik T C 19: 23,652,698 E10G unknown Het
1700029J07Rik A G 8: 45,956,460 F274S probably damaging Het
2210408I21Rik A G 13: 77,323,607 S1044G probably benign Het
4930578C19Rik T A X: 18,423,552 I224F possibly damaging Het
4931409K22Rik T C 5: 24,550,733 probably null Het
9930021J03Rik T C 19: 29,720,574 probably benign Het
Aanat A G 11: 116,596,904 H143R probably benign Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcb1a G T 5: 8,674,856 probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Alk T C 17: 71,895,935 Y1135C probably damaging Het
Atad2b C T 12: 4,965,915 T547I probably damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Clec4f T A 6: 83,652,997 N193I probably damaging Het
Col4a4 A T 1: 82,529,656 probably null Het
Cplx4 T G 18: 65,957,045 D101A possibly damaging Het
Cpne8 A T 15: 90,649,271 D50E probably damaging Het
Ctdp1 A G 18: 80,469,521 V9A probably benign Het
Ctnnd2 A T 15: 30,332,155 probably benign Het
Cyp7b1 C T 3: 18,097,510 A180T probably benign Het
D3Ertd254e T A 3: 36,164,786 Y319* probably null Het
Dcun1d5 C T 9: 7,203,379 probably benign Het
Dgat1 G T 15: 76,502,999 L363I possibly damaging Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dnah6 T C 6: 73,124,757 N1928S probably benign Het
Dync2h1 A T 9: 7,041,734 probably benign Het
Ednra T G 8: 77,720,020 probably benign Het
Efcab6 A T 15: 83,918,292 C845S probably benign Het
Egln1 A T 8: 124,915,696 C303S probably damaging Het
Eomes T C 9: 118,482,300 probably null Het
Epha1 A G 6: 42,363,822 V568A probably benign Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Fbxo46 T C 7: 19,135,729 V91A probably damaging Het
Fryl A T 5: 73,041,332 probably benign Het
Gab3 A C X: 75,033,418 D43E probably damaging Het
Gltpd2 T A 11: 70,519,709 probably benign Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm7353 T C 7: 3,110,570 noncoding transcript Het
Grik4 T C 9: 42,688,109 probably benign Het
Gtpbp2 G T 17: 46,165,969 A358S possibly damaging Het
Hyls1 C T 9: 35,561,232 C296Y probably damaging Het
Igf2r C T 17: 12,692,101 M1943I probably benign Het
Ireb2 T A 9: 54,896,577 N517K probably damaging Het
Itga10 A G 3: 96,653,660 S614G possibly damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif17 T C 4: 138,298,231 M948T possibly damaging Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Llph T A 10: 120,228,181 C67* probably null Het
Lrrn3 T C 12: 41,454,034 T95A probably damaging Het
Map3k12 C A 15: 102,502,178 A455S probably damaging Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Myo7b A G 18: 32,000,070 W409R probably damaging Het
Nbea A G 3: 56,009,340 M833T possibly damaging Het
Ncapg A G 5: 45,679,894 T436A probably null Het
Nkx1-2 C A 7: 132,599,313 D72Y probably null Het
Olfr1532-ps1 T A 7: 106,915,110 I304K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr815 T A 10: 129,901,882 N276I probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcnx2 A G 8: 125,886,926 probably benign Het
Pcsk1 G A 13: 75,097,977 G158D probably damaging Het
Phkb A T 8: 86,017,441 D573V probably damaging Het
Pik3r4 A G 9: 105,667,771 K150E possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Ppp4r4 C T 12: 103,600,495 A67V probably damaging Het
Prex2 A G 1: 11,181,898 T1056A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Psd T C 19: 46,313,441 E903G probably damaging Het
Psg19 T C 7: 18,794,062 E252G probably benign Het
Psg20 T A 7: 18,681,044 K306* probably null Het
Pygl T G 12: 70,194,374 probably benign Het
Rasgrf2 A G 13: 91,982,771 S724P probably damaging Het
Reck C A 4: 43,922,967 A414D probably damaging Het
Scn10a C A 9: 119,630,147 V1150L probably damaging Het
Shc2 A T 10: 79,629,917 I187N probably damaging Het
Sipa1l3 T A 7: 29,387,291 K625* probably null Het
Slc44a4 T C 17: 34,928,490 L583P possibly damaging Het
Slc5a11 G C 7: 123,258,420 R244P possibly damaging Het
Slfn8 T A 11: 83,003,581 Q744L probably benign Het
Snx2 G T 18: 53,176,416 V13L probably benign Het
Spsb1 C T 4: 149,906,415 probably null Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Svil G T 18: 5,097,494 R1659L probably damaging Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tmem9 A T 1: 136,034,188 T174S possibly damaging Het
Tnks2 T C 19: 36,890,050 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ttf2 A G 3: 100,969,549 probably benign Het
Ubr7 C A 12: 102,769,191 T303N probably damaging Het
Ushbp1 A T 8: 71,390,224 probably null Het
Vmn1r177 C A 7: 23,866,050 V134F probably benign Het
Vmn2r12 A G 5: 109,087,850 probably null Het
Vmn2r53 T G 7: 12,601,214 H173P probably benign Het
Wdr78 T C 4: 103,049,386 probably benign Het
Yars A T 4: 129,197,155 M119L probably damaging Het
Zcrb1 A T 15: 93,397,157 probably benign Het
Zfp319 C A 8: 95,329,622 probably benign Het
Zfp783 C G 6: 47,943,386 noncoding transcript Het
Zfyve26 A G 12: 79,273,598 I1024T possibly damaging Het
Other mutations in Csmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Csmd3 APN 15 48287495 missense possibly damaging 0.61
IGL00591:Csmd3 APN 15 48004883 missense probably damaging 1.00
IGL00668:Csmd3 APN 15 47913945 missense probably damaging 1.00
IGL00753:Csmd3 APN 15 47644235 missense probably damaging 1.00
IGL00773:Csmd3 APN 15 47590719 missense probably damaging 0.96
IGL00926:Csmd3 APN 15 47710964 missense possibly damaging 0.87
IGL00942:Csmd3 APN 15 47847106 critical splice donor site probably null
IGL01080:Csmd3 APN 15 47881403 missense probably benign 0.12
IGL01314:Csmd3 APN 15 47849755 missense probably damaging 1.00
IGL01326:Csmd3 APN 15 47849785 missense probably benign 0.06
IGL01393:Csmd3 APN 15 48457599 missense possibly damaging 0.88
IGL01432:Csmd3 APN 15 47733499 missense probably damaging 1.00
IGL01519:Csmd3 APN 15 47596850 missense probably benign 0.31
IGL01530:Csmd3 APN 15 47838437 missense possibly damaging 0.95
IGL01530:Csmd3 APN 15 47669617 missense probably damaging 1.00
IGL01547:Csmd3 APN 15 47883617 missense probably benign 0.41
IGL01594:Csmd3 APN 15 47629239 missense probably benign 0.01
IGL01618:Csmd3 APN 15 48011083 missense probably benign 0.05
IGL01670:Csmd3 APN 15 47611829 missense probably damaging 1.00
IGL01680:Csmd3 APN 15 47970030 missense probably damaging 1.00
IGL01734:Csmd3 APN 15 48185304 missense probably damaging 1.00
IGL01777:Csmd3 APN 15 47698198 missense probably benign 0.06
IGL01779:Csmd3 APN 15 47857894 missense probably benign 0.10
IGL01820:Csmd3 APN 15 47607142 nonsense probably null
IGL01843:Csmd3 APN 15 47658999 splice site probably benign
IGL01919:Csmd3 APN 15 47675772 missense possibly damaging 0.62
IGL01986:Csmd3 APN 15 47659195 missense possibly damaging 0.82
IGL02049:Csmd3 APN 15 48001474 missense possibly damaging 0.91
IGL02065:Csmd3 APN 15 47666628 missense probably damaging 1.00
IGL02112:Csmd3 APN 15 48313869 missense possibly damaging 0.95
IGL02133:Csmd3 APN 15 47857942 missense possibly damaging 0.86
IGL02203:Csmd3 APN 15 47849677 splice site probably null
IGL02215:Csmd3 APN 15 47585688 missense probably damaging 1.00
IGL02234:Csmd3 APN 15 47948116 missense probably damaging 1.00
IGL02326:Csmd3 APN 15 47755963 splice site probably benign
IGL02478:Csmd3 APN 15 47838398 splice site probably benign
IGL02491:Csmd3 APN 15 47914115 splice site probably benign
IGL02598:Csmd3 APN 15 47669690 missense probably damaging 0.98
IGL02626:Csmd3 APN 15 47704107 splice site probably benign
IGL02696:Csmd3 APN 15 47669669 missense probably benign 0.33
IGL02876:Csmd3 APN 15 47606096 splice site probably benign
IGL02971:Csmd3 APN 15 47913929 splice site probably benign
IGL03068:Csmd3 APN 15 47847121 missense possibly damaging 0.69
IGL03087:Csmd3 APN 15 47977033 missense probably damaging 1.00
IGL03114:Csmd3 APN 15 47820451 missense probably damaging 0.99
IGL03146:Csmd3 APN 15 47881477 missense probably benign 0.25
IGL03193:Csmd3 APN 15 47629230 splice site probably benign
IGL03274:Csmd3 APN 15 47645504 missense probably damaging 1.00
R0040:Csmd3 UTSW 15 47633816 missense probably damaging 1.00
R0071:Csmd3 UTSW 15 47596821 missense probably benign 0.04
R0071:Csmd3 UTSW 15 47596821 missense probably benign 0.04
R0119:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0124:Csmd3 UTSW 15 47590716 missense probably damaging 1.00
R0127:Csmd3 UTSW 15 47981930 missense probably benign 0.45
R0136:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0201:Csmd3 UTSW 15 47619729 splice site probably benign
R0240:Csmd3 UTSW 15 47629239 missense probably benign 0.05
R0240:Csmd3 UTSW 15 47629239 missense probably benign 0.05
R0318:Csmd3 UTSW 15 47659153 missense probably damaging 1.00
R0369:Csmd3 UTSW 15 47970147 missense probably damaging 1.00
R0391:Csmd3 UTSW 15 47657573 missense probably damaging 1.00
R0499:Csmd3 UTSW 15 47847131 missense probably benign 0.08
R0506:Csmd3 UTSW 15 48457511 missense probably benign 0.00
R0606:Csmd3 UTSW 15 48457662 missense probably benign
R0639:Csmd3 UTSW 15 47913940 missense probably damaging 1.00
R0658:Csmd3 UTSW 15 48011147 missense possibly damaging 0.66
R0673:Csmd3 UTSW 15 47913940 missense probably damaging 1.00
R0689:Csmd3 UTSW 15 47756025 missense probably benign 0.19
R0696:Csmd3 UTSW 15 47847173 missense probably benign 0.01
R0799:Csmd3 UTSW 15 48185384 splice site probably benign
R0834:Csmd3 UTSW 15 47883677 intron probably benign
R0926:Csmd3 UTSW 15 47977033 missense probably damaging 1.00
R0943:Csmd3 UTSW 15 47675739 missense probably damaging 0.99
R0944:Csmd3 UTSW 15 47611831 missense probably damaging 1.00
R0967:Csmd3 UTSW 15 47857831 missense probably null 0.89
R0973:Csmd3 UTSW 15 47659089 missense probably damaging 1.00
R1055:Csmd3 UTSW 15 47881537 missense probably damaging 1.00
R1066:Csmd3 UTSW 15 47913965 missense probably damaging 1.00
R1086:Csmd3 UTSW 15 47695755 missense probably damaging 0.99
R1103:Csmd3 UTSW 15 47948006 missense probably damaging 1.00
R1136:Csmd3 UTSW 15 47675817 missense probably damaging 1.00
R1139:Csmd3 UTSW 15 47695836 missense probably damaging 1.00
R1158:Csmd3 UTSW 15 48292774 splice site probably null
R1215:Csmd3 UTSW 15 48004831 unclassified probably null
R1233:Csmd3 UTSW 15 48673531 missense probably damaging 1.00
R1271:Csmd3 UTSW 15 48011059 missense probably benign 0.11
R1469:Csmd3 UTSW 15 47669202 nonsense probably null
R1469:Csmd3 UTSW 15 47669202 nonsense probably null
R1479:Csmd3 UTSW 15 47857886 missense probably damaging 1.00
R1480:Csmd3 UTSW 15 47731929 missense possibly damaging 0.90
R1526:Csmd3 UTSW 15 47585632 critical splice donor site probably null
R1527:Csmd3 UTSW 15 47948087 missense probably benign 0.08
R1539:Csmd3 UTSW 15 47820398 missense probably benign 0.24
R1544:Csmd3 UTSW 15 47611898 splice site probably null
R1548:Csmd3 UTSW 15 47981975 missense possibly damaging 0.91
R1574:Csmd3 UTSW 15 47695861 splice site probably null
R1574:Csmd3 UTSW 15 47695861 splice site probably null
R1619:Csmd3 UTSW 15 47949950 missense probably damaging 1.00
R1630:Csmd3 UTSW 15 47838522 missense possibly damaging 0.66
R1665:Csmd3 UTSW 15 47696789 missense probably damaging 1.00
R1680:Csmd3 UTSW 15 47741170 missense probably damaging 1.00
R1725:Csmd3 UTSW 15 47596807 missense probably damaging 1.00
R1743:Csmd3 UTSW 15 48622089 missense probably damaging 1.00
R1749:Csmd3 UTSW 15 47585660 missense probably damaging 1.00
R1752:Csmd3 UTSW 15 47660273 missense probably benign 0.15
R1769:Csmd3 UTSW 15 47704109 splice site probably benign
R1775:Csmd3 UTSW 15 47899739 missense probably damaging 0.99
R1795:Csmd3 UTSW 15 47857920 missense possibly damaging 0.95
R1819:Csmd3 UTSW 15 47753735 missense possibly damaging 0.56
R1840:Csmd3 UTSW 15 47607164 missense probably damaging 1.00
R1860:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R1861:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R1879:Csmd3 UTSW 15 47657519 missense possibly damaging 0.90
R1958:Csmd3 UTSW 15 48004639 critical splice donor site probably null
R1965:Csmd3 UTSW 15 47849748 missense probably benign 0.15
R1970:Csmd3 UTSW 15 48673531 missense probably damaging 1.00
R2029:Csmd3 UTSW 15 47838579 missense probably damaging 1.00
R2051:Csmd3 UTSW 15 48621993 critical splice donor site probably null
R2108:Csmd3 UTSW 15 48004861 missense possibly damaging 0.81
R2132:Csmd3 UTSW 15 48457503 missense probably benign 0.06
R2146:Csmd3 UTSW 15 47741236 frame shift probably null
R2147:Csmd3 UTSW 15 47741236 frame shift probably null
R2148:Csmd3 UTSW 15 47741236 frame shift probably null
R2157:Csmd3 UTSW 15 47695787 missense probably damaging 0.99
R2159:Csmd3 UTSW 15 47741236 frame shift probably null
R2160:Csmd3 UTSW 15 47741236 frame shift probably null
R2161:Csmd3 UTSW 15 47741236 frame shift probably null
R2162:Csmd3 UTSW 15 47741236 frame shift probably null
R2164:Csmd3 UTSW 15 47741236 frame shift probably null
R2213:Csmd3 UTSW 15 47820447 missense possibly damaging 0.92
R2301:Csmd3 UTSW 15 47731998 missense probably damaging 1.00
R2302:Csmd3 UTSW 15 48314051 missense probably benign
R2355:Csmd3 UTSW 15 47741236 frame shift probably null
R2497:Csmd3 UTSW 15 47741236 frame shift probably null
R2509:Csmd3 UTSW 15 47741236 frame shift probably null
R2566:Csmd3 UTSW 15 47741236 frame shift probably null
R2567:Csmd3 UTSW 15 47741236 frame shift probably null
R2568:Csmd3 UTSW 15 47741236 frame shift probably null
R2570:Csmd3 UTSW 15 47741236 frame shift probably null
R2571:Csmd3 UTSW 15 47741236 frame shift probably null
R2870:Csmd3 UTSW 15 47857924 missense probably damaging 1.00
R2870:Csmd3 UTSW 15 47857924 missense probably damaging 1.00
R2907:Csmd3 UTSW 15 48011053 missense probably damaging 0.99
R3116:Csmd3 UTSW 15 47657599 missense probably damaging 1.00
R3423:Csmd3 UTSW 15 47847252 missense probably damaging 0.98
R3425:Csmd3 UTSW 15 47847252 missense probably damaging 0.98
R3508:Csmd3 UTSW 15 47741236 frame shift probably null
R3746:Csmd3 UTSW 15 47849766 missense probably benign 0.04
R3813:Csmd3 UTSW 15 48791813 missense possibly damaging 0.82
R3832:Csmd3 UTSW 15 47741236 frame shift probably null
R3959:Csmd3 UTSW 15 47644189 missense probably benign 0.18
R4042:Csmd3 UTSW 15 47614084 missense probably damaging 1.00
R4043:Csmd3 UTSW 15 47755966 critical splice donor site probably null
R4191:Csmd3 UTSW 15 47847271 missense probably damaging 0.99
R4192:Csmd3 UTSW 15 47847271 missense probably damaging 0.99
R4419:Csmd3 UTSW 15 47704311 missense probably damaging 1.00
R4426:Csmd3 UTSW 15 47669185 missense possibly damaging 0.51
R4434:Csmd3 UTSW 15 47899795 missense possibly damaging 0.68
R4438:Csmd3 UTSW 15 47899795 missense possibly damaging 0.68
R4490:Csmd3 UTSW 15 48314033 missense possibly damaging 0.83
R4562:Csmd3 UTSW 15 47899844 missense probably benign 0.32
R4604:Csmd3 UTSW 15 48004815 missense possibly damaging 0.90
R4620:Csmd3 UTSW 15 47585753 missense probably benign 0.09
R4632:Csmd3 UTSW 15 48011209 missense probably damaging 0.99
R4679:Csmd3 UTSW 15 48161083 nonsense probably null
R4696:Csmd3 UTSW 15 47913968 missense probably benign 0.24
R4718:Csmd3 UTSW 15 47698150 nonsense probably null
R4723:Csmd3 UTSW 15 47669160 missense probably benign 0.29
R4801:Csmd3 UTSW 15 47621292 missense probably damaging 1.00
R4802:Csmd3 UTSW 15 47621292 missense probably damaging 1.00
R4806:Csmd3 UTSW 15 48314068 missense probably benign
R4816:Csmd3 UTSW 15 47857934 missense possibly damaging 0.68
R4935:Csmd3 UTSW 15 48161084 missense probably damaging 1.00
R4955:Csmd3 UTSW 15 48673518 missense probably damaging 0.99
R4991:Csmd3 UTSW 15 48001478 missense probably damaging 1.00
R5031:Csmd3 UTSW 15 47659192 missense probably damaging 1.00
R5034:Csmd3 UTSW 15 47629287 missense possibly damaging 0.94
R5035:Csmd3 UTSW 15 47590779 missense probably damaging 1.00
R5120:Csmd3 UTSW 15 48673495 nonsense probably null
R5224:Csmd3 UTSW 15 47888684 missense possibly damaging 0.91
R5235:Csmd3 UTSW 15 47629278 missense probably benign 0.20
R5279:Csmd3 UTSW 15 48791944 unclassified probably null
R5360:Csmd3 UTSW 15 47669203 missense probably damaging 0.99
R5365:Csmd3 UTSW 15 48004749 missense possibly damaging 0.68
R5379:Csmd3 UTSW 15 47636450 nonsense probably null
R5381:Csmd3 UTSW 15 47741215 missense probably benign 0.21
R5393:Csmd3 UTSW 15 47633703 missense probably damaging 1.00
R5413:Csmd3 UTSW 15 47838435 missense probably damaging 1.00
R5549:Csmd3 UTSW 15 48185357 missense probably damaging 0.98
R5550:Csmd3 UTSW 15 48185357 missense probably damaging 0.98
R5551:Csmd3 UTSW 15 48314096 missense probably benign 0.13
R5567:Csmd3 UTSW 15 47645468 missense possibly damaging 0.92
R5621:Csmd3 UTSW 15 48313978 missense possibly damaging 0.84
R5668:Csmd3 UTSW 15 47695755 missense possibly damaging 0.48
R5677:Csmd3 UTSW 15 48622051 missense probably damaging 0.98
R5701:Csmd3 UTSW 15 47650221 missense probably damaging 1.00
R5701:Csmd3 UTSW 15 48540333 missense probably damaging 0.99
R5871:Csmd3 UTSW 15 47888716 missense probably damaging 0.98
R5872:Csmd3 UTSW 15 47582527 missense probably damaging 1.00
R5874:Csmd3 UTSW 15 47644270 missense probably damaging 1.00
R5952:Csmd3 UTSW 15 47733505 missense probably damaging 0.98
R5956:Csmd3 UTSW 15 48791882 missense possibly damaging 0.84
R5966:Csmd3 UTSW 15 47849739 missense probably damaging 0.96
R5969:Csmd3 UTSW 15 47947990 missense probably damaging 1.00
R5989:Csmd3 UTSW 15 47590764 missense possibly damaging 0.69
R6017:Csmd3 UTSW 15 48314012 missense possibly damaging 0.95
R6057:Csmd3 UTSW 15 47755391 missense probably damaging 1.00
R6127:Csmd3 UTSW 15 47650228 missense probably damaging 1.00
R6178:Csmd3 UTSW 15 48673458 missense probably damaging 1.00
R6198:Csmd3 UTSW 15 48313877 missense probably benign 0.28
R6213:Csmd3 UTSW 15 47629260 missense probably damaging 1.00
R6256:Csmd3 UTSW 15 47669729 missense probably damaging 1.00
R6274:Csmd3 UTSW 15 47621437 missense probably benign
R6327:Csmd3 UTSW 15 47881387 missense probably damaging 1.00
R6354:Csmd3 UTSW 15 47881489 missense probably damaging 1.00
R6405:Csmd3 UTSW 15 47820371 missense probably damaging 0.99
R6410:Csmd3 UTSW 15 48673407 missense probably damaging 1.00
R6416:Csmd3 UTSW 15 48673560 missense probably damaging 1.00
R6463:Csmd3 UTSW 15 47676479 missense probably damaging 1.00
R6536:Csmd3 UTSW 15 47838467 missense probably damaging 1.00
R6625:Csmd3 UTSW 15 47607075 missense probably benign 0.02
R6695:Csmd3 UTSW 15 47857834 missense probably damaging 0.99
R6895:Csmd3 UTSW 15 47666514 splice site probably null
R6906:Csmd3 UTSW 15 47847173 missense probably benign 0.01
R6914:Csmd3 UTSW 15 48011138 missense possibly damaging 0.53
R6920:Csmd3 UTSW 15 47644205 missense probably damaging 1.00
R7024:Csmd3 UTSW 15 47710991 missense probably damaging 1.00
R7178:Csmd3 UTSW 15 47590774 missense
R7192:Csmd3 UTSW 15 47704237 missense
R7220:Csmd3 UTSW 15 48457598 missense probably damaging 0.99
R7362:Csmd3 UTSW 15 47755992 missense possibly damaging 0.65
R7380:Csmd3 UTSW 15 47586965 missense
R7397:Csmd3 UTSW 15 47695734 missense
R7467:Csmd3 UTSW 15 47629244 missense
R7585:Csmd3 UTSW 15 48622075 missense possibly damaging 0.76
R7623:Csmd3 UTSW 15 47949938 missense
R7649:Csmd3 UTSW 15 47669143 missense
R7691:Csmd3 UTSW 15 47741173 missense
R7695:Csmd3 UTSW 15 47820381 missense
R7759:Csmd3 UTSW 15 47698173 missense
R7817:Csmd3 UTSW 15 47857960 missense probably damaging 0.99
U24488:Csmd3 UTSW 15 47710399 missense probably damaging 1.00
V8831:Csmd3 UTSW 15 48457696 missense probably damaging 0.96
X0021:Csmd3 UTSW 15 47970093 nonsense probably null
Z1088:Csmd3 UTSW 15 47636393 missense probably damaging 1.00
Z1088:Csmd3 UTSW 15 47847281 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGGGTACACACATACTCCTCTGAGAT -3'
(R):5'- TGGTACAGCAAGAGAAAACAAGCTCC -3'

Sequencing Primer
(F):5'- GTGCTTAATAACATCAATGCCAGC -3'
(R):5'- ccccaacccacccaaac -3'
Posted On2013-11-08