Incidental Mutation 'R0898:Nabp1'
ID 83735
Institutional Source Beutler Lab
Gene Symbol Nabp1
Ensembl Gene ENSMUSG00000026107
Gene Name nucleic acid binding protein 1
Synonyms 4933440J18Rik, Nbp1, 4930442A21Rik, Obfc2a, 4930434H03Rik, Ssb2, 5830411E10Rik, 4930488J04Rik
MMRRC Submission 039058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock # R0898 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 51465862-51478425 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51471337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 169 (I169V)
Ref Sequence ENSEMBL: ENSMUSP00000140556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027279] [ENSMUST00000185534] [ENSMUST00000186003] [ENSMUST00000186684] [ENSMUST00000188051] [ENSMUST00000188204] [ENSMUST00000189542] [ENSMUST00000190103]
AlphaFold Q8BGW5
Predicted Effect probably benign
Transcript: ENSMUST00000027279
AA Change: I169V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027279
Gene: ENSMUSG00000026107
AA Change: I169V

DomainStartEndE-ValueType
PDB:4OWX|B 10 142 2e-72 PDB
SCOP:d1fgua1 11 84 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185534
AA Change: I89V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107
AA Change: I89V

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185961
Predicted Effect probably benign
Transcript: ENSMUST00000186003
AA Change: I89V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140126
Gene: ENSMUSG00000026107
AA Change: I89V

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186684
AA Change: I89V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107
AA Change: I89V

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188051
AA Change: I89V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107
AA Change: I89V

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188204
AA Change: I89V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107
AA Change: I89V

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188303
Predicted Effect probably benign
Transcript: ENSMUST00000189542
AA Change: I89V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140059
Gene: ENSMUSG00000026107
AA Change: I89V

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190103
AA Change: I169V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140556
Gene: ENSMUSG00000026107
AA Change: I169V

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 27 108 2.8e-7 PFAM
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,424,076 probably null Het
Apmap A G 2: 150,585,749 probably benign Het
Arhgap11a T C 2: 113,836,876 N442S probably benign Het
Bpifb5 C T 2: 154,233,334 A394V probably benign Het
Brpf3 A G 17: 28,806,990 T346A possibly damaging Het
Ccdc154 A G 17: 25,164,081 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Col3a1 T C 1: 45,333,993 probably benign Het
Cpm A C 10: 117,676,106 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Ddx59 T C 1: 136,416,941 Y117H probably damaging Het
Fam241b A G 10: 62,108,994 F98L probably damaging Het
Fmn2 G A 1: 174,503,460 G472E unknown Het
Gcdh T C 8: 84,893,560 H41R possibly damaging Het
Gm7713 A C 15: 59,994,441 noncoding transcript Het
Gmeb1 T C 4: 132,234,782 T189A probably benign Het
Iqck G A 7: 118,971,441 C272Y probably damaging Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Map3k1 T C 13: 111,767,956 probably benign Het
Olfr761 T C 17: 37,952,236 T263A probably benign Het
Olfr898 G A 9: 38,349,442 V120M probably damaging Het
Pfkm A G 15: 98,128,230 I569V probably benign Het
Plcb1 A T 2: 135,387,143 T1096S possibly damaging Het
Plscr4 A C 9: 92,484,753 D140A probably damaging Het
Plxna2 A G 1: 194,797,024 D1331G probably damaging Het
Ppfia4 T C 1: 134,321,126 T498A probably benign Het
Prkar2b A T 12: 31,963,002 L372I possibly damaging Het
Rslcan18 T C 13: 67,098,816 N120S probably benign Het
Sbf2 C T 7: 110,371,652 V846I possibly damaging Het
Slc16a7 A G 10: 125,233,501 I102T possibly damaging Het
Slc1a4 T C 11: 20,304,349 T506A probably damaging Het
Slc22a7 T C 17: 46,433,149 T462A probably damaging Het
Sox11 T C 12: 27,341,225 Y395C probably damaging Het
Taf2 T C 15: 55,060,084 T266A probably damaging Het
Tanc1 C T 2: 59,790,788 T317I probably damaging Het
Tnxb T C 17: 34,670,745 S71P probably damaging Het
Tpgs2 G A 18: 25,149,150 P115S probably damaging Het
Trmt10a C T 3: 138,149,518 P139L probably damaging Het
Zfp113 T C 5: 138,144,789 S400G probably benign Het
Other mutations in Nabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Nabp1 APN 1 51477528 missense probably damaging 1.00
kinkajou UTSW 1 51471352 missense possibly damaging 0.70
R1608:Nabp1 UTSW 1 51473003 splice site probably null
R1614:Nabp1 UTSW 1 51471352 missense possibly damaging 0.70
R1956:Nabp1 UTSW 1 51477845 missense probably damaging 0.96
R2208:Nabp1 UTSW 1 51477614 nonsense probably null
R4632:Nabp1 UTSW 1 51474602 nonsense probably null
R5996:Nabp1 UTSW 1 51471385 missense probably benign 0.00
R6754:Nabp1 UTSW 1 51474540 missense probably damaging 0.97
R7322:Nabp1 UTSW 1 51473070 missense probably damaging 0.98
R8251:Nabp1 UTSW 1 51477578 missense probably benign 0.04
R8302:Nabp1 UTSW 1 51472339 missense probably benign 0.00
X0063:Nabp1 UTSW 1 51477849 missense probably benign 0.00
Z1176:Nabp1 UTSW 1 51477725 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGGTGTCTTAAGTAACTCACCCTC -3'
(R):5'- GTTAATACACTTGTCCAGCCCAGAGC -3'

Sequencing Primer
(F):5'- GGACAGGTTTTCAAGTGATACCC -3'
(R):5'- AGAATAAAAGTGCTGGTTTTTCCTGG -3'
Posted On 2013-11-08